Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx

... expansion of the cyclin gene family in diatoms and discovered a new cyclin class, the diatom- specific cyclins. The latter are most prob- ably involved in signal integration to the cell cycle because transcript ... Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium...

Ngày tải lên: 09/08/2014, 20:21

... release [69]. It also affected the activities of lysosomal enzymes, decreasing the activities of arylsulfatase A and arysulfatase B, an N-acetyl- galactosaminidase-4-sulfatase, but increasing the ... Ascorbic acid serves as a cofactor for prolyl and lysyl hydroxylases, enzymes crucial in collagen synthesis. In vitro, ascorbate and ascorbic acid increased protein and pro- teo...

Ngày tải lên: 09/08/2014, 08:22

... intrathecal baclofen withdrawal, highlights the possibility that, rather than representing a true physiological withdrawal syndrome, abrupt withdrawal of intrathecal baclofen may simply precipitate ... insufficiency, and acute renal failure secondary to rhabdomyolysis. Intrathecally administered baclofen, delivered by an implantable pump system, is widely used for the treatment of r...

Ngày tải lên: 11/08/2014, 03:21

... withdrawal, highlights the possibility that, rather than representing a true physiological withdrawal syndrome, abrupt withdrawal of intrathecal baclofen may simply precipitate an episode of status ... renal failure secondary to rhabdomyolysis. Intrathecally administered baclofen, delivered by an implantable pump system, is widely used for the treatment of refractor y spasticity...

Ngày tải lên: 11/08/2014, 07:20

... data analysis and interpretation of the study. DS participated in the data analysis, literature search, revision of the bibliography, the revision and editing of most of the manuscript. BM participated ... competing interests. Authors' contributions MS participated in the study design, data analysis and inter- pretation of the data as well as the writin...

Ngày tải lên: 25/10/2012, 10:31

... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... 2100 Bioanalyzer System (Agilent Technologies, Santa Clara, CA, USA) to verify the integrity of the RNA samples. Gene expression analysis by real-time qP...

Ngày tải lên: 09/08/2014, 23:20

... lesions and poorly differentiated papillary mucinous cystadeno- carcinoma from the right ovary. There wer e several par- enchymal metastases in the spleen, and intra-abdominal dissemination of the ... carcinoma. Gynecol Oncol 1988, 30:143-148. 12. Minagawa Y, Kanamori Y, Ishihara H, Morishita K, Kigawa J, Ito T, Maeda K, Saito S: Solitary metastatic ovarian carcinoma of the sp...

Ngày tải lên: 11/08/2014, 14:21

... promotes the release of proinflammatory cytokines and leads to a higher expression of TLR2. In ankylosing spondylitis (AS), as in other immune-mediated diseases, an unusual proinflammatory and cytotoxic ... enrolled into the study. Spondyloarthropathy was defined according to the European Spondyloarthropathy Study Group criteria [26]. Out of the spondyloarthropathy- define...

Ngày tải lên: 09/08/2014, 07:20

... BrdU incorporation was measured by a colorimetric assay as a parameter for DNA synthesis. For evaluation of cell viability and metabolic activity the MTT assay was used. The assay is based on the ... tissue into the synovium may play a role in the initiation and perpetuation of inflammation and degradation processes. RAGE as well as AGEs are present in the synovial...

Ngày tải lên: 09/08/2014, 14:22

... [1]. Also of interest, and a situation where a greater body of clinical data exists, is the potential use of CpG ODNs as vaccine adjuvants [2,1]. By improving the kinetics, magnitude and avidity of ... which included HIV+ subjects, aged 18–55 years was conducted at The Ottawa Hospital Clinical Investigation Unit, Ottawa, Canada. The study was approved by The Ottawa Hospi...

Ngày tải lên: 11/08/2014, 10:23