Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx
Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx
... unsupervised analyses also revealed heterogeneity among the sepsis signature. Canonical pathway and gene network analysis of the 37 classifiersFigure 7 Canonical pathway and gene network analysis of the ... forward primer, 5'-gctggaaagctgagagagactt-3', and reverse primer, 5'-cctgat- gcagaccataaaagg-3'; HLA-DMA [GenBank:NM_006120.3 ] forward primer, 5'-agct...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: "Most nuclear systemic autoantigens are extremely disordered proteins: implications for the etiology of systemic autoimmunity" pps
... they may be masked and physically unavailable to the immune system [49]. Finally, as shown by the ProPred analysis, disordered regions are only rarely apt to be T cell epitopes. In summary, the ... participate in autoimmune disease. Some of these predictions are characteristic of a wide range of models of autoimmunity and are, therefore, not terribly informative in deciding f...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt
... Hata K, Andoh A, Shimada M, Fujino S, Bamba S, Araki Y, Okuno T, Fujiyama Y, Bamba T: IL-17 stimulates inflammatory responses via NF-kappaB and MAP kinase pathways in human colonic myofibroblasts. ... induced a weak activation of Fra-1 and TNF-α induced an activation of FosB and Fra-1. The combination of these two cytokines at low concentrations induced the nuclear translocatio...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... (5'-CACTG- TACCAGTGCAGTAG-3') and antisense (5'-ACCAT- TCACACACT CGTTAT-3') primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG-3') and antisense (5'- CATTTGCCACGAGTGGGTAG-3') ... catabolism by regulatory T cells. Nat Immunol 2003, 4:1206-1212. 32. Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O: Regulation of indoleamine 2,3-...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx
... models of severe sepsis and systemic infection. Crit Care 2007, 11:R122. 70. Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto ... role in the pathogenesis of a wide variety of inflammatory conditions and may present a new target of therapy for RA and related rheumatic diseases. Future studies will...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot
... replacement the factors that may mainly favor PVL formation are the annulus calcification and infections. We report a case of paraprosthetic l eakage, occurring seven years after AVR using a continuous ... Luisa Gregorini and Francesco Alamanni Abstract We report a case of redo aortic prosthesis replacement for a severe paravalvular leak (PVL) in a man operated with contin...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx
... was conducted and analyzed as described [32]. The primer pair for nppa was F-GGCAACAGAA- GAGGCATCAGAG and R-GGAGCTGCTGCTTC CTCTCGGTC. The primer pair for b-actin was F- CCATTGGCAATGAGAGGTTCAG ... interpretation of data and helped to draft the manuscript. SPLH participated in the design of this study, performed statistical analysis, interpretation of data and draft the manu...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Rho kinase inhibitors Y27632 and H1152 augment neurite extension in the presence of cultured Schwann cells" pdf
... both the glial scar and in myelin – NOGO and myelin associated glycopeptide (MAG) [1]. These sub- stances inhibit axonal regeneration by activating on RhoA, a member of the Rho GTPase family. Active ... prepared from sciatic nerves of 2 to 3-day-old Wistar rats. These were surplus animals from the animal breeding program belonging to the Fac- ulty of Veterinary Science of t...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Arch height change during sit-to-stand: an alternative for the navicular drop test" pot
... and Dana Hilz 1 Address: 1 Gait Research Laboratory, Program in Physical Therapy, Northern Arizona University, Flagstaff, Arizona, USA, 2 Medoff Physical Therapy, Flagstaff, Arizona, USA and ... and carried out data analyses. BV participated in the design of the study and carried out data analyses. KKF coordinated and carried out data analyses. DH coordinated and carried out data ana...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Arch height change during sit-to-stand: an alternative for the navicular drop test" pptx
... lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited ... http://www.biomedcentral.com/1757-1146/2/17 Page 2 of 2 (page number not for citation purposes) Correction Correction to be made on the spelling of an author's name and em...
Ngày tải lên: 10/08/2014, 21:23