Báo cáo y học: "Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcript" ppt

... selection. MFB and JZL analyzed the sequence data. XA and AG confirmed fusion transcripts and SNPs, respectively. JZL, CN, LAG, and AG conceived and directed the research. Additional data files The ... alignment parameters and coverage levels. Validation of sequence alterations Novel SNPs called by RNA-Seq were validated by traditional bidirectional Sanger sequencing...

Ngày tải lên: 09/08/2014, 20:20

... coronary angiography for any indication and had no history of a coronary revascularization procedure prior to the scheduled angiography. Forty-four patients had a history of myocardial infarction ... 260 and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial infarction. Health Technol Assess. 2004; 8: 1...

Ngày tải lên: 08/08/2014, 16:23

... data provides detection of hemodynamically relevant CAD in patients with a history of coronary revascularization with high sensitivity and specificity that appears to be at least as good as ... of relevant restenosis, de-novo stenosis, and graft stenosis as diagnosed with coronary angiography in patients after coronary revascularization that is at least as good as that of...

Ngày tải lên: 08/08/2014, 17:20

... Hematology, University of Perugia, Perugia, Italy). The forward and backward primers were: 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGAT GGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined ... was dialysed against phosphate-buffered saline (PBS) overnight at 4°C and stored at -80°C before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay Kit (Be- y...

Ngày tải lên: 08/08/2014, 18:21

... nucleotide variants and overlap between datasets We used SAMtools to call SNVs in our aligned gDNA and cDNA sequences. Indels and large structural variants were not analyzed. SAMtools called 51,055 ... data for a more easily accessible tissue such as skin for this exon array publicly available; however, one can extrapolate that adding cDNA from almost any tissue would be similarly...

Ngày tải lên: 09/08/2014, 20:22

... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... inhibition of the miR-30 family, RNA was extracted and analyzed at day 10 of differentiation. (b) For over-expression of pre-miR3 0a and pre-miR-30d,...

Ngày tải lên: 09/08/2014, 23:20

... remaining sites ATCAGC GGTAATGA CATAGGGAT ATCAGC GGTAATGA CATAGGGAA ATCAGC GGTAATGA CATAGGGA T ATCAGC GGTAATGA CATAGGGAA GSS GSS GSS GSS SNP A- genome A- genome B-genome ATCAGC GGTA TGA CATAGGGATA ATCAGC ... phenotypic variation that eventually can play a critical role in the origin of new adaptations and important agronomic traits. Background Comparative analysis of grass genomes r...

Ngày tải lên: 09/08/2014, 23:20

... DNA sample of a Moroccan Jewish proband, eval- uated by this approach, led to the discovery of four mutations, two of them novel, and solved the cause of hearing loss of a n additional 20 families. ... Materials and methods. Discovery of novel mutations In each of the 11 probands, multiple potentially func- tional variants of predicted damaging effect were identi-...

Ngày tải lên: 09/08/2014, 23:20

... Kause J, Smith G, Prytherch D, Parr M, Flabouris A, Hillman K: Australian and New Zealand Intensive Care Society Clinical Trials Group. A comparison of antecedents to cardiac arrests, deaths and ... Instead, as in the case of cardiac arrest and trauma teams, change in practice may be slow and progressive, even in the absence of level I evidence. It appears likely that the acc...

Ngày tải lên: 25/10/2012, 10:35

... recovery was une- ventful, and the patient was discharged on postoper- ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... of a monolayer of inner circular muscle, which makes its wall weak, as com- pared to the small intestine that is formed of the inner circular and outer longitudinal muscle lay...

Ngày tải lên: 25/10/2012, 10:51