Báo cáo y học: " Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell" potx
Báo cáo y học: " Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell" potx
... 10:R114Open Access2009von Dassowet al.Volume 10, Issue 10, Article R114Research Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally ... Inc., Santa Clara, California, USA). The 260:280 ratioswere typically greater than 2.2 and absence of degradationwas evidenced by sharp 18 s and 28 s bands. Equal amounts of total RNA from each ... and a summary of RT-PCR resultsin Tables S1 and S2 (Additional data file 7); a detailed descrip-tion of identification and analysis of flagellar-relatedhomologs (Additional data file 8); an...
- 33
- 652
- 0
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"
... 4.53 3.3 TTCATCCGTCACAGGAGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAACAAACG GGGCAAGTTCAGCAGAAACAdecorin (Dcn) ... TCGTTGGAGTGACATCGTCT GCTCCCACAATGAAGCATTT Actin, cyto-plasmic 1 (Beta-actin) NAP018710-001 B-actin 2.78 2.14 3.51 NC CTAAGGCCAACCGTGAAAAG CCATCACAATGCCTGTGGTA Mouse MHC class I H2-K-alpha-2 ... thymocytes. The thymocytes were processed by using the RNEasy Mini Kit (Qiagen, Valencia, CA). Quality and quantity of total RNA samples was assessed us-ing an Agilent 2100 Bioanalyzer (Agilent...
- 14
- 464
- 0
Báo cáo Y học: Agmatine oxidation by copper amine oxidase Biosynthesis and biochemical characterization of N-amidino-2-hydroxypyrrolidine pdf
... of kcat and K0mare independent of the enzyme assay.Biosynthesis of N-amidino-2-hydroxypyrrolidineN-Amidino-2-hydroxypyrrolidine was synthesized as fol-lows. Twenty micrograms of P. sativum ... chemicals were from MerckAG (Darmstadt, Germany). All products were of analyticalor reagent grade and u sed without further purification.AnimalsMale Sprague–Dawley rats (from Morini, I taly), ... N-amidino-2-hydroxypyrrolidine maybe envisaged, as reported for agmatine [7].As a w hole, agmatine oxidation by P. sativum copperamine oxidase may represent a new biocatalytic route forthe synthesis of N-amidino-2-hydroxypyrrolidine,...
- 9
- 403
- 0
Báo cáo y học: "Higher susceptibility to Fas ligand induced apoptosis and altered α modulation of cell death by tumor necrosis factor-α in periarticular tenocytes from patients with knee joint osteoarthritis" ppt
... tenocytes.23. Wakisaka S, Suzuki N, Takeba Y, Shimoyama Y, Nagafuchi H,Takeno M, Saito N, Yokoe T, Kaneko A, Asai T, Sakane T: Modu-lation by proinflammatory cytokines of Fas/Fas ligand-medi-ated apoptotic ... of Fas in osteoarthritis (OA) and control tenocytes. (a) Expression of Fas mRNA was analyzed by quantitative real-time PCRusing the TaqMan®system (Applied Biosystems, Weiterstadt, Germany).Expression ... death. Of note, apopto-sis of fibroblast-like cells is regulated at a number of differ-ent levels, and there is evidence that secondarymodulation of signalling pathways downstream of Fas mayalter...
- 9
- 419
- 0
Báo cáo y học: "Patients, their doctors, nonsteroidal anti-inflammatory drugs and the perception of risk" docx
... certainty). For an event that has a relativelyhigh background rate, such as heart disease or cancer, a fewevents in a database of several hundred subjects may not beadequate to signal a drug-related ... pharmacovigilance.Pharmacovigilance is defined as ‘all observational (non-randomized) postapproval scientific and data gatheringactivities relating to the detection, assessment and under-standing of adverse ... currentlyimpossible to numerically assess small but potentiallyimportant risks of drug therapy.Beyond the premarketing assessment of safety, additionalsafety information comes mostly from pharmacovigilance.Pharmacovigilance...
- 4
- 322
- 0
Báo cáo y học: "Cell signalling in macrophages, the principal innate immune effector cells of rheumatoid arthritis" pps
... 41:92-104.139. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M,Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E,Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T:Osteoclast differentiation ... expression in rheumatoid arthritis synovialmacrophages. Arthritis Rheum 2006, 54:2711-2721.122. Takasugi K, Yamamura M, Iwahashi M, Otsuka F, Yamana J, Suna-hori K, Kawashima M, Yamada M, Makino H: ... Bucala R, Bernhagen J: Rapid and transient acti-vation of the ERK MAPK signalling pathway by macrophagemigration inhibitory factor (MIF) and dependence on JAB1/CSN5 and Src kinase activity....
- 12
- 233
- 0
Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot
... R Anju, Sadanandan Jayanarayanan and Cheramadatikudiyil S Paulose*AbstractBackground-: Hypoxia during the first week of life can induce neuronal death in vulnerable brain regions usuallyassociated ... through a- decarboxylation of glutamic acid catalyzed by glutamate decarboxylase(GAD; EC 4.1.1.15) under the presence of cofactor pyri-doxal 5’-phoshate. GAD, the rate limiting enzyme of GABA synthesis ... understandingthe alterations in GABA content, total GABA and GABABreceptors and GAD expression in the cerebel-lum and brain stem of hypoxic neonatal rats and theeffects of various resuscitations...
- 11
- 467
- 0
Báo cáo y học: "Augmented low-Dye tape alters foot mobility and neuromotor control of gait in individuals with and without exercise related leg pain" docx
... acquisition of data,performed analysis and interpretation of data and drafted the manuscript.ARC contributed to conception and design, assisted with analysis and interpretation of data and assisted ... reduc-tion in MG activation, and a small increase in PLactivation with application of ALD tape. This supportspreliminary findings of tape-induced reductions in TP and TA activation in a small cohort ... University of Queensland GraduateSchool for funding a Research Travel Grant for MF; and Bob Buckley fordesigning a software program for data processing.Author details1The University of Queensland,...
- 9
- 355
- 0
Báo cáo y học: "Peripheral blood but not synovial fluid natural killer T cells are biased towards a Th1-like phenotype in rheumatoid arthritis" pptx
... Chiba A, Oki S, Miyamoto K, Hashimoto H, Yamamura T, Miyake S:Suppression of collagen-induced arthritis by natural killer Tcell activation with OCH, a sphingosine-truncated analog of alpha-galactosylceramide. ... out all experiments and drafted the manuscript. MTparticipated in frequency analysis of NKT cells. KB partici-pated in reactivity assays. PG provided clinical material. VS and JR critically revised ... ana-lyzed on a ABI Prism 310 Genetic Analyser (AppliedBiosystems).Statistical analysis Differences in the percentage of NKT cells between healthycontrol individuals and RA patients and between...
- 10
- 352
- 0
Báo cáo y học: " Acute lyme infection presenting with amyopathic dermatomyositis and rapidly fatal interstitial pulmonary fibrosis: a case report" docx
... neuromuscular abnormalties, and arthralgias. The severity of these symptoms may vary dueto complex interactions between the vector, bacteria, and host factors which ultimately result in inflammatory cas-cades ... amy-opathic dermatomyositis and rapidly fatal interstitial pulmonary fibrosis: a case report Journal of Medical Case Reports 2010, 4:187JOURNAL OF MEDICALCASE REPORTSNguyen et al. Journal ... proximal muscle weakness of lower and then upper extremities, progressive dyspnea,facial and palmar dermatitis, and ten pound weight loss.Physical examination of our patient revealed an illappearing,...
- 5
- 348
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ