Báo cáo y học: " Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell" potx
... 10:R114 Open Access 2009von Dassowet al.Volume 10, Issue 10, Article R114 Research Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally ... Inc., Santa Clara, California, USA). The 260:280 ratios were typically greater than 2.2 and absence of degradation was evidenced by sharp 18 s and 28 s...
Ngày tải lên: 09/08/2014, 20:20
... 4.53 3.3 TTCATCCGTCACAGG AGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAA CAAACG GGGCAAGTTCAGCAGAAACA decorin (Dcn) ... TCGTTGGAGTGACAT CGTCT GCTCCCACAATGAAGCATTT Actin, cyto- plasmic 1 (Beta-actin) NAP018710-0 01 B-actin 2.78 2.14 3.51 NC CTAAGGCCAACCGTG AAAAG CCATCACAATGCCTGTGGTA Mouse MHC class I H2-...
Ngày tải lên: 03/11/2012, 11:35
... of k cat and K 0 m are independent of the enzyme assay. Biosynthesis of N -amidino-2-hydroxypyrrolidine N-Amidino-2-hydroxypyrrolidine was synthesized as fol- lows. Twenty micrograms of P. sativum ... chemicals were from Merck AG (Darmstadt, Germany). All products were of analytical or reagent grade and u sed without further purification. Animals Male Sprague–Dawley rats (from Mo...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo y học: "Higher susceptibility to Fas ligand induced apoptosis and altered α modulation of cell death by tumor necrosis factor-α in periarticular tenocytes from patients with knee joint osteoarthritis" ppt
... tenocytes. 23. Wakisaka S, Suzuki N, Takeba Y, Shimoyama Y, Nagafuchi H, Takeno M, Saito N, Yokoe T, Kaneko A, Asai T, Sakane T: Modu- lation by proinflammatory cytokines of Fas/Fas ligand-medi- ated apoptotic ... of Fas in osteoarthritis (OA) and control tenocytes. (a) Expression of Fas mRNA was analyzed by quantitative real-time PCR using the TaqMan ® system (Applied Biosystems...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Patients, their doctors, nonsteroidal anti-inflammatory drugs and the perception of risk" docx
... certainty). For an event that has a relatively high background rate, such as heart disease or cancer, a few events in a database of several hundred subjects may not be adequate to signal a drug-related ... pharmacovigilance. Pharmacovigilance is defined as ‘all observational (non- randomized) postapproval scientific and data gathering activities relating to the detection, assessme...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Cell signalling in macrophages, the principal innate immune effector cells of rheumatoid arthritis" pps
... 41:92-104. 139. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T: Osteoclast differentiation ... expression in rheumatoid arthritis synovial macrophages. Arthritis Rheum 2006, 54:2711-2721. 122. Takasugi K, Yamamura M, Iwahashi M, Otsuka F, Yamana J, Suna- hori K, Ka...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot
... R Anju, Sadanandan Jayanarayanan and Cheramadatikudiyil S Paulose * Abstract Background-: Hypoxia during the first week of life can induce neuronal death in vulnerable brain regions usually associated ... through a- decarboxylation of glutamic acid catalyzed by glutamate decarboxylase (GAD; EC 4.1.1.15) under the presence of cofactor pyri- doxal 5’-phoshate. GAD, the rate limiting en...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Augmented low-Dye tape alters foot mobility and neuromotor control of gait in individuals with and without exercise related leg pain" docx
... acquisition of data, performed analysis and interpretation of data and drafted the manuscript. ARC contributed to conception and design, assisted with analysis and interpretation of data and assisted ... reduc- tion in MG activation, and a small increase in PL activation with application of ALD tape. This supports preliminary findings of tape-induced reductions in...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Peripheral blood but not synovial fluid natural killer T cells are biased towards a Th1-like phenotype in rheumatoid arthritis" pptx
... Chiba A, Oki S, Miyamoto K, Hashimoto H, Yamamura T, Miyake S: Suppression of collagen-induced arthritis by natural killer T cell activation with OCH, a sphingosine-truncated analog of alpha-galactosylceramide. ... out all experiments and drafted the manuscript. MT participated in frequency analysis of NKT cells. KB partici- pated in reactivity assays. PG provided clinical mater...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: " Acute lyme infection presenting with amyopathic dermatomyositis and rapidly fatal interstitial pulmonary fibrosis: a case report" docx
... neuromuscular abnormalties, and arthralgias. The severity of these symptoms may vary due to complex interactions between the vector, bacteria, and host factors which ultimately result in inflammatory cas- cades ... amy- opathic dermatomyositis and rapidly fatal interstitial pulmonary fibrosis: a case report Journal of Medical Case Reports 2010, 4:187 JOURNAL OF MEDICAL CASE R...
Ngày tải lên: 11/08/2014, 12:20