Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps

Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps

Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps

... p300, to primary response genes to maintain an active chromatin acetylation signature. Inducible transcription factors then recruit different acetylases that modify a different set of lysines on the ... respec- tively, were acetylated in the unstimulated cells, only 3% (two genes) of the promoters of primary response genes became transiently acetylated at 0.5 h followi...

Ngày tải lên: 09/08/2014, 20:20

18 641 0
Báo cáo y học: "Immunocytokines: the long awaited therapeutic magic bullet in rheumatoid arthritis" ppsx

Báo cáo y học: "Immunocytokines: the long awaited therapeutic magic bullet in rheumatoid arthritis" ppsx

... protein directed against an irrelevant protein antigen. Concomitant neutralization of signaling? Unfortunately, they did not include in their studies the therapeutic impact of the targeting antibody ... [1] showed that cytokines can be targeted to the site of interest by using scFv antibody fragments recognizing extracellular matrix (ECM) components present in the joint. Th...

Ngày tải lên: 09/08/2014, 14:22

2 272 0
Báo cáo y học: " Microarray-based genomic surveying of gene polymorphisms in Chlamydia trachomatis" ppsx

Báo cáo y học: " Microarray-based genomic surveying of gene polymorphisms in Chlamydia trachomatis" ppsx

... B/TW-5 indicated that these genes are absent or otherwise highly divergent (Table 1). As this region was not highly ranked in any of the other strains, the results indicated that the trp operon ... they are present in the test- or in the reference-strain gene. An insertion in a test-strain gene will cause the region to be longer than the complementary sequence on th...

Ngày tải lên: 09/08/2014, 20:20

9 545 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

... hormone [38,40]. The changes engineered in the sequence of the peptide, either through the nature of the side chain of the new amino acids or through their non-native conforma- tional features, increase the ... Analysis of the distribution of the electrostatic potential on the surface of the molecule reveals the ampiphilic character of the helix (Fig....

Ngày tải lên: 17/03/2014, 10:20

11 515 0
Báo cáo Y học: Reconstructing the replication complex of AcMNPV pdf

Báo cáo Y học: Reconstructing the replication complex of AcMNPV pdf

... CCGCCCGGGTTATTTTTTCA GGCCCGGGCTCGAGTTTTTT TTTTATAC CATTTTATAC IE1 5¢ CTATGACGCAAATTAATTTT GGCCCGGGAATTCACGCAAA AACGC TTAATTTTAACGC IE1 3¢ CCGCCCGGGTTATCGCCAAC GGCCCGGGCTCGAGTCGCC TCCCATTGTTAAT AACTCCCATTGTTAAT IE2 ... CATCACGATCTATGTTAGT GGCCCGGGAATTCATGTTAG GTGCAATTATAC TGTGCAATTATAC LEF-1 3¢ CCGCCCGGGTTATGTGGTAC GGCCCGGGAGCTCTTATGTG TTTTTG GTACTTTTTG LEF-2 5¢ CATCACAGATCTATGGCGA GGCCCGGGAGC...

Ngày tải lên: 23/03/2014, 21:20

8 443 0
Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt

Báo cáo Y học: Optimizing the delivery systems of chimeric RNA . DNA oligonucleotides Beyond general oligonucleotide transfer ppt

... be transported easily in the cytoplasm. Fourth, they should enter the nucleus easily. For transfection in vivo,this is one of the most important hurdles. Finally, cytotoxity is another major ... covalently lactosylated, forming a lactose–PEI complex. The complex carrying RDO was administrated by tail vein injection into rats either once or repeatedly at fixed intervals. The res...

Ngày tải lên: 31/03/2014, 08:20

6 425 0
Báo cáo khao học: "Defining the transition from earlywood to latewood in black spruce based on intra-ring wood density profiles from X-ray densitometry" pot

Báo cáo khao học: "Defining the transition from earlywood to latewood in black spruce based on intra-ring wood density profiles from X-ray densitometry" pot

... used to describe the intra-ring wood density profile, 4th to 6th order polynomial were tested. The E/L transition was defined as the inflexion point. The latter is obtained by equalling the second ... derivative of the spline function. Theoretically, the maxi - mum represents an inflexion point in the intra-ring wood den - sity profile and could be determined mathematicall...

Ngày tải lên: 08/08/2014, 14:20

8 252 0
Báo cáo y học: "To the Editor: We have diagnosed a patient from Quebec" ppsx

Báo cáo y học: "To the Editor: We have diagnosed a patient from Quebec" ppsx

... CD154 def icienc y: normal growth, the presence of lym- phadenopa th y , infections only of bacterial origin, and the lac k of c ytopenias. Our pa tient’s AID m uta tion pr oved to be identical to that found ... patient’s mutation proved to be identical to that of all other French Canadians with AID defects. This case illustrates the clinical nature of AID deficiency, and...

Ngày tải lên: 08/08/2014, 21:20

2 325 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

... and simvastatin are semi-synthetic derivatives, whereas fluvastatin, atorvastatin and rosuvastatin are entirely synthetic [1]. Lovastatin and simvastatin are of the lactone Review Do the pleiotropic ... therapy has even short-term benefits when administered in the setting of the acute coronary syndrome in patients with normal cholesterol levels. The MIRACL study demonstrated...

Ngày tải lên: 09/08/2014, 06:22

7 334 0
Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx

Báo cáo y học: " Unraveling the genomic diversity of small eukaryotes" potx

... duplications. The origin of the Metazoa is a landmark event in the history of life and we are now taking critical steps in the under- standing of this major transition. The oomycetes are another group ... being detected in the greatest numbers. Protist genomes and metagenomes Several presentations sought to further our understanding of a major transition in evolu...

Ngày tải lên: 09/08/2014, 20:21

3 279 0
w