Báo cáo sinh học: "Expression of X chromosome fragility in Holstein-Friesian cattle: a preliminary study" pps
...
Ngày tải lên: 09/08/2014, 18:22
... group. Functional parameters Animals were placed in individual metabolic cages for blood and urine collection. Functional parameters were measured using an automatic analyzer (Modular auto- matic analyzer, ... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transplant 2...
Ngày tải lên: 18/06/2014, 19:20
... level in the urine revealed a superiority of MP in maintaining tissue integrity at all time point, which was confirmed by histological analysis of the grafts parenchyma. Early follow up of ViaspanUW-M ... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transpl...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
... subcloned into the pcDNA3.1(+) vector and the myc-tag was fused to the C-terminus of RSV-F by ligating annealed primers (Sigma) mycTAAs: 5'- tcgaggaacaaaaactcatctcagaagaggatctgtaat and mycTAAa: 5'-ctagattacagatcctcttctgagatgagtttttgttcc ... System, Invitrogen) the RSV-F cDNA was amplified by PCR (Primers (Sigma): sense: 5'-gatccaagcttccaccatggagttgccaatcctcaaa; antisense: 5&a...
Ngày tải lên: 18/06/2014, 18:20
Tài liệu Báo cáo khoa học: Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions doc
... (5¢-AACATCTTCAAGGA GCGTGGCATC-3¢)andBE3P1(5¢-AGACAGCAGGA GACTCACAATCAC-3¢), were used to amplify a C. rein- hardtii expressed sequence tag (EST), BE337478, from a strain 21gr cDNA library kindly ... motifs found in the catalytic H-cluster of [Fe]-hydrogenases, motif 1 (PMFTSCCPxW), motif 2 (MPCxxKxxExxR) and motif 3 (FxExMACxGxCV), have also been found in the algal sequences and are...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx
... obtained from Amersham International Biotech (Amersham, Bucks, UK), the antibody to human UCP3 C-terminus (CabrX) from Research Diagnostics, Inc (San Antonio, LA, USA) and the monoclonal antibody ... be appear to be an indication of UCP3 activity in rodent muscle. The observation of a marked increase in UCP3 Fig. 5. Effect of a 24-h fast on (A) UCP3 protein levels and (B) COX pro...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: Expression of MsPG3-GFP fusions in Medicago truncatula Ôhairy rootsÕ reveals preferential tip localization of the protein in root hairs pot
... This transformation system is faster and cheaper than complete plant transformation and has the advantages of stable transgenic material over transient assays, in which damage often occurs during ... used in this work were: 5038 ()12): 5¢-CTAA GAATTCACATGGATAGGA AA-3¢; PG3B (1984): 5¢-GG GGATCCGCTTCTGCTGC AGTTGTGC-3¢;EPS-1(72):5¢-CC CCATGGCTAAT ATCTTTGATATAAA-3¢;EPS-2(49):5¢-CCACCAG GAT...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot
... PAPP -A as a unique metalloproteinase. EXPERIMENTAL PROCEDURES Cloning of cDNAs encoding murine PAPP -A and PAPP-Ai Overlapping, murine cDNA clones encoding murine PAPP- A of 1545 residues and a ... PAPP-Ai mRNA likely results from alternative splicing of a transcript from the same gene. Expression and functional analysis of murine PAPP -A and PAPP-Ai The proteolytic domain...
Ngày tải lên: 31/03/2014, 21:21
báo cáo sinh học:"Strategies to overcome physician shortages in northern Ontario: A study of policy implementation over 35 years Raymond W Pong" pdf
... assistance Telehealth Research 1969 x x x x 1970 x 1972 x 1977 x 1978 x 1979 xx 1980 1982 x x x 1985 x 1991 x 1992 x x 1994 x x 1995 xx 1996 x x x 1997 xx 1998 xxx 1999 xxx 2000 xxx 2001 x 2002 xx x xx 2004 x Note: ... operation was chosen as the initiation year. In the case of the NOSM, 2002 was chosen because the Founding Dean was appointed in that y...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... 315:740-743. 26. Thomas DR: A General Inductive Approach for Qualitative Data Analysis. Aukland: University of Aukland; 2003. 27. Alonso-Garbayo A, Maben J: Internationally Recruited Nurses from India and the ... Ireland appears to have envisaged international recruitment campaigns as a means of importing hard-working nurses on a temporary basis as a stop-gap solution to staffin...
Ngày tải lên: 18/06/2014, 17:20