Báo cáo sinh học: "A comparison between the β-globin gene cl

Tài liệu Báo cáo khoa học: A role for the intersubunit disulﬁdes of seminal RNase in the mechanism of its antitumor action docx

... A role for the intersubunit disulﬁdes of seminal RNase in the mechanism of its antitumor action Aurora Bracale 1, *, Francesco Castaldi 1, *, Lucio Nitsch 2 and Giuseppe D’Alessio 1 1 Dipartimento ... proposed for the mechanism of antitumour action of BS -RNase is based on the ability of the protein to resist the neutralizing action of...

Ngày tải lên : 20/02/2014, 11:20

8
604
0

Báo cáo sinh học: " No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients" pdf

... Xia et al.: No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients. Journal of Translational Medicine 2011 9:88. Xia et al. Journal of Translational ... location, none of the mast cell counts was correlated with the 5-year survival rate. These data argue against the hypothesis that mast cel...

Ngày tải lên : 18/06/2014, 19:20

6
468
0

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Corresponding author Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures ... strains from databases we found that 74 (61.2 %) out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' e...

Ngày tải lên : 20/06/2014, 01:20

4
329
0

Báo cáo toán học: "A Relationship Between the Major Index For Tableaux and the Charge Statistic For Permutations" pptx

... of the ﬁnite general linear group GL n (q). The polynomial f λ (q) can be computed as the generating function for the major index maj(T ) on the set of standard Young tableaux of shape ... ch(π)=  i cc(i). For the previous example, the charge contribution of each element is given below that element: π =328574619 782530000 3 Charge and Inv Many of the known res...

Ngày tải lên : 07/08/2014, 13:21

9
276
0

Báo cáo sinh học: "A comparison of four systems of group mating for avoiding inbreeding" pdf

... population size in circular group mating is larger than

Ngày tải lên : 09/08/2014, 18:22

19
259
0

Báo cáo sinh học: "A comparison between the β-globin gene clusters of domestic sheep (Ovis aries) and Sardinian mouflon" docx

... Original article A comparison between the β-globin gene clusters of domestic sheep (Ovis aries) and Sardinian mouflon (Ovis gmelini musimon) A Rando 1 P Di Gregorio 2 M ... established whether the marked differences in the frequencies of ’switching’ and ’non-switching’ chromosomes between Sardinian mouflon and sheep are...

Ngày tải lên : 09/08/2014, 18:22

6
316
0

Báo cáo sinh học: " A note on the rationale for estimating genealogical coancestry from molecular markers" doc

... on molecular marker data are functions of the genealogical coancestry. From these formulas, it is easy to derive estimators of genealogical coancestry from molecular data. We include variation ... individuals. Such marker-based relatedness is valuable in many areas of research on the evolution and conservation of natural populations, for example for estimating her...

Ngày tải lên : 14/08/2014, 13:21

10
394
0

Báo cáo sinh học: " A mutation in the MATP gene causes the cream coat colour in the horse" pot

... 129 ● ●● ● Cr ATGGGTGGCAACAGTGGGCAGCCTGGCGTTCCCACCTATAAGTCCCTAGCTGAGGATGGCCCCTTTGGCTCCGTGGAGC ATGGGTGGCAACAGTGGGCAGCCTGGCGTTCCCACCTATAAGTCCCTAGCTGAGGATGGCCCCTTTGGCTCCGTGGAGC ATGAGTGGAAGCAATGGGCCGACTGACACCCATACCTATCAATCCTTAGCCGAGGATTGCCCCTTTGGCTCTGTGGAGC ATGGGTAGCAACAGTGGGCAGGCTGGCCGCCACATCTATAAATCCCTAGCTGATGATGGCCCCTTTGACTCTGTGGAGC Cr GCCCAAAAGATCCACGGGCAGGCTCGTCATGCACAGCATGGCCATGTTCGGCCGGGAA...

Ngày tải lên : 14/08/2014, 13:21

15
178
0

Báo cáo sinh học: "A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB) in two French draft horse breeds" doc

... mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB) in two French draft horse breeds Dragan M ILENKOVIC , Stéphane C HAFFAUX , Sead T AOURIT , Gérard G UÉRIN ∗ Laboratoire ... A LAMC2 mutation involved in horse JEB 255 of epidermolysis in the horse, their incidence in different breeds and the identiﬁcati...