Báo cáo khoa hoc:" Construction and characterization of a bo

Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx

... a bovine BAC library with four genome-equivalent coverage André E GGEN a, ∗ , Mathieu G AUTIER a , Alain B ILLAUT d , Élisabeth P ETIT a , Hélène H AYES a , Pascal L AURENT a , Catherine U RBAN b , Martha ... represented in BAC libraries is around 28. Added to the bovine YAC, ovine BAC [10] and goat BAC [8] libraries hosted at Inra, this gives a 15 genome-e...

Ngày tải lên : 09/08/2014, 18:21

6
271
0

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Puriﬁcation and characterization ... ground was used for the analyses. (A) Total RNA was extracted and 20 lg RNA was loaded in each lane and blotted as indicated in Experimental procedures. To prove equal loading of the...

Ngày tải lên : 16/03/2014, 18:20

14
565
0

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done ... T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GG...

Ngày tải lên : 19/02/2014, 06:20

14
650
0

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic ... 5907 Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H + /peptide cotransporters Ilka Knu ¨ tter 1 , Bianka Hartrodt 2 ,Ge ´ za To ´ th 3...

Ngày tải lên : 07/03/2014, 05:20

10
490
0

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulﬁde reductase from Pyrococcus horikoshii Implications for the disulﬁde metabolism of anaerobic hyperthermophiles doc

... (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) ... blast and tfasta analysis of the phCoADR revealed a signiﬁcant level of identity to putative NADH oxidases from hyperthermophiles and bacterial NADH o...

Ngày tải lên : 07/03/2014, 17:20

12
420
0

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... enzyme has a tetrameric conformation with a molecular mass of  155 kDa. The catalytic activity of the enzyme increases up to 100 °C, and a half-life of 11 min at this temperature indicates its ... (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order to introduce an NcoI restriction site, an extra a...

Ngày tải lên : 16/03/2014, 14:20

8
415
0

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢). These primers contained BstEII and BamHI sites and were used to generate a fragment that was cloned in the same sequencing and ... FEBS 9 Martı ´ nez-Ruiz A, Garcı ´ a- Ortega L, Kao R, Lacadena J, On ˜ aderra M, Manchen ˜ o JM, Davies J, Martı ´ nez del Pozo A & Gavilanes JG (2001) RNase U2 and a- sarcin:...

Ngày tải lên : 16/03/2014, 19:20

9
517
0

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the speciﬁc and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Seiichiro Ikeda 1 , Shinya Kajita 1 , Masaya Nakamura 2 and Yoshihiro Katayama 1 1 Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, ... Cloning and sequencing of the gene for a Pseudomonas paucimobilis enzyme that cleaves beta-aryl ether. J. Bacteriol. 173, 7950–7955. 14. Masai,E.,Katayama,Y.,Kubota,S.,Kawai,...

Ngày tải lên : 17/03/2014, 03:20

10
670
0

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereas agglutination was inhibited by galactose and its deriva- tives [such as N-acetylgalactosamine (GalNAc), methyl -a- d-galactopyranoside], it was evident...

Ngày tải lên : 18/02/2014, 16:20

12
763
0

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A...

Ngày tải lên : 19/02/2014, 07:20

19
706
0