Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf

Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf

Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf

... computed separately. The objective of the present paper is to develop a rapid method to obtain the inverse of the covariance matrix of the additive effects of a marked QTL in the case of complete marker ... elements of the inverse are discussed. 2. TABULAR METHODS FOR THE COVARIANCE MATRIX AND THE INVERSE The covariance of marked...
Ngày tải lên : 09/08/2014, 18:21
  • 21
  • 304
  • 0
Báo cáo khoa học: "Treatment planning using MRI data: an analysis of the dose calculation accuracy for different treatment regions" ppt

Báo cáo khoa học: "Treatment planning using MRI data: an analysis of the dose calculation accuracy for different treatment regions" ppt

... phantom provided by the vendor for each available CT tube vol- tage. The HU homogeneity was verified us ing a CAT- PHAN 600 phantom (The Phantom Laboratory, Salem, NY, USA), and the peripheral HU value varied ... comparisons for all geometries. The figure shows PTV DVH comparisons between bulk density assigned data and CT data for the head and neck patients. The exact s...
Ngày tải lên : 09/08/2014, 09:20
  • 8
  • 348
  • 0
báo cáo khoa học: "Adenoid cystic carcinoma intermingled with ductal carcinoma of the breast: a case report and review of the literature" docx

báo cáo khoa học: "Adenoid cystic carcinoma intermingled with ductal carcinoma of the breast: a case report and review of the literature" docx

... the de-differ- entiation patterns. Another implication of mixed ACC breast cancers is the type of appropriate adjuvant treat- ment, as a chemotherapeutic agent or radiotherapy may not necessarily ... presented an ACC with spindle-cell carcinoma and melanoma (Table 1). The diagnosis may be challenging in mixed ACC cases, as some clinical and radiological features can be misleading....
Ngày tải lên : 10/08/2014, 23:20
  • 4
  • 381
  • 0
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

... vials, and centrifuged for 15 min at 16 000 g and the supernatant was transferred to new vials. A fraction was retained for determination of total protein. The remainder of the supernatant was ... of DA is thought to be maintained by a regulated balance between the functional levels of plasma mem- brane DAT and vesicular VMAT-2. The protein a- synuclein (a- syn) i...
Ngày tải lên : 14/02/2014, 21:20
  • 13
  • 596
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

... zinc-bound Ab and soluble copper-bound GIF [38]. Therefore, the metal swap led to simultaneous modification of the final form of Ab(1–40) and suggests that it caused the de-aggregation of Ab. In a therapeutic ... the levels of GIF are altered dramatically in the neurode- generative or traumatically injured brain. The best- characterized example of this is for AD. Indee...
Ngày tải lên : 16/02/2014, 15:20
  • 9
  • 664
  • 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... immunoreactive Grb14 was examined using preparative and analytical fractionation and compared to that of the IR. Upon differential centrifugation (Fig. 1A) , Grb14 was detect- able as a major protein of 60 kDa in ... Incorporated (Lake Placid, NY, USA). Monoclonal antibody against EEA1 (clone 14) was from BD Transduction Laboratories (San Jose, CA, USA). Monoclonal antibody against Na...
Ngày tải lên : 18/02/2014, 18:20
  • 15
  • 497
  • 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... that the maximum stability and activity of the AAP occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different ... of AAP, as described in the Materials and methods. Completion of the hydrolysis was confirmed by the disappearance of the (Met1)-ONC (M23L) signal in the...
Ngày tải lên : 19/02/2014, 12:20
  • 9
  • 704
  • 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTA CTTGAGTCA Sy...
Ngày tải lên : 07/03/2014, 00:20
  • 11
  • 432
  • 0
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx

Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx

... However, the position of the samples in Fig. 4A is influenced by the level of all variables in these samples. For example, the samples of the strains in the third quadrant of Fig. 4A have a tendency ... The assays for G6P, F6P, PYR, ADP, AMP, NAD and ATP were also as described by Ruijter and Visser [41]. The assay for 6PG was the same as for G6P, except th...
Ngày tải lên : 07/03/2014, 17:20
  • 13
  • 382
  • 0
Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx

Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx

... detection. Newman et al. (2003), and later Mihalcea and Strapparava (2009), ask participants to give both their true and untrue views on personal issues (e.g., their stance on the death penalty). Zhou et al. ... opinions total). 3.1 Deceptive opinions via Mechanical Turk Crowdsourcing services such as AMT have made large-scale data annotation and collection efforts fi- nancially affordable b...
Ngày tải lên : 07/03/2014, 22:20
  • 11
  • 464
  • 0