Báo cáo khoa hoc:" A repetitive probe for FISH analysis of bovine interphase nuclei" doc
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... GGGTTCT AACAAG
GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab-
start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG-3Â.
The ... according to the manufacturer’s guidelines and
using the following primers: Aba, 5Â-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT
GGTGT...
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
... distribu-
tion and require supervised /semi-supervised infor-
mation for learning. We propose a flexible genera-
tive model for transliteration mining usable for both
unsupervised and semi-supervised ... super-
vised and semi-supervised systems we mentioned,
our model can be used for both unsupervised and
semi-supervised mining in a consistent way.
3 Unsupervi...
Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot
...
files for providing a grammatical
analysis of -n~estricted English text.
From 1981-83, a suite of PASCAL
programs was devised to automatically
produce a single level of grammatical
description ...
automatically. The remaining 3 to ~ per
cent were corrected by human post-editors.
~brk is now in progress to devise a
suite of programs to provide a
constituent...
Báo cáo khoa học: "A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Features in Chinese Text Categorization" potx
...
Abstract
Words and character-bigrams are both
used as features in Chinese text process-
ing tasks, but no systematic comparison
or analysis of their values as features for
Chinese text categorization ... 2006.
c
2006 Association for Computational Linguistics
A Comparison and Semi-Quantitative Analysis of Words and
Character-Bigrams as Featu...
Báo cáo khoa học: "A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants" docx
... Linguistics
A Bootstrapping Approach to Unsupervised Detection of Cue Phrase
Variants
Rashid M. Abdalla and Simone Teufel
Computer Laboratory, University of Cambridge
15 JJ Thomson Avenue, Cambridge CB3 OFD, ... investigate the unsupervised detection
of semi-fixed cue phrases such as “This
paper proposes a novel approach. . .
1
”
from unseen text, on the basis of o...
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... squamous cell
carcinoma and five human melanomas. Thus, these data
clarify in detail the cutaneous expression of the P450scc
system; they also amplify and extend recent information on
an active P450scc ... 353
4184 A. Slominski et al.(Eur. J. Biochem. 271) Ó FEBS 2004
A novel pathway for sequential transformation of 7-dehydrocholesterol
and expression...
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... on the point estimation of words’
context profiles obtained from a limited
amount of data. This paper proposes a
Bayesian method for robust distributional
word similarities. The method uses a ... calculation of distributional similarity. The
method is straightforward: Instead of using the
point estimation of v(w
i
), we first estimate the
distribution of the cont...
Báo cáo khoa học: "A Structured Model for Joint Learning of Argument Roles and Predicate Senses" pot
... F
P
Plemma of the predicate and predicate s head, and ppos of the predicate
Dependency label between the predicate and predicate s head
The concatenation of the dependency labels of the predicate s ... between the predicate and the argument candidates
The number of dependency edges between the predicate and the argument candidate
F
P A
Plemma and plemma&...
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... is the first time the biosensor
assay for MAP has been demonstrated.
Materials and Methods
Bacterial strain and growth
Mycobacterium avium subsp. paratuberculosis- 66115-98,
a clinical isolate ... study indicated that the lateral flow
biosensor assay was effective, even in the detection of 10
MAP organisms in the spiked fecal samples. Apart from
the...
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... knowledge, represents the first in the
literature describing a multidisciplinary approach for the
successful management of a large metastasic GIST to the
liver. We attribute the success of this case to ... with a history of a bowel resection 7 years prior for a primary GIST of the small bowel.
The finding of a heterogeneous mass 15.5 cm in diameter replaci...
Báo cáo khoa hoc:" A repetitive probe for FISH analysis of bovine interphase nuclei" doc
... 555–560.
[8] de Sario A. , Vagnarelli P., De Carli L., Aneuploidy assay on diethylstilbestrol
by means of in situ hybridization of radioactive and biotinylated DNA probes on
interphase nuclei, Mutat. Res. ... 83–690.
[18] Iwasaki S., Hamano S., Kuwayama M., Yamashita M., Ushijima H., Na-
gaoka S., Nakahara T., Developmental changes in the incidence of chromosome ab-
normalities of...
Báo cáo khoa hoc:" A sampling algorithm for segregation analysis" ppt
... D.B., Bayesian Data Analysis, Chap-
man and Hall, London, 1995.
[6] Geman S., Geman D., Stochastic relaxation, Gibbs distribution and the Bayesian
restoration of images, IEEE Transactions on Pattern ... data are available on others,
as is the case for genetic disorders, is more complicated and is addressed in a
separate paper [10].
When all genotypes are unknown any randomly drawn descent...
Báo cáo khoa hoc:"A higher resolution radiation hybrid map of bovine chromosome 13" docx
... into the evolutionary development of the chromosome as compared to man.
bovine chromosome 13 / radiation hybrid / gene mapping / 12
000 rad / comparative
mapping
∗
Correspondence and reprints
E-mail: ... Taylor J.F., Cytogenetic alignment of the bovine chromosome 134 genome
map by fluorescence in situ hybridization of human chromosome 10 and 20
comparative markers, C...
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... Lightspeed, USA) at 120 kV and
200 mA.
Analysis
The data obtained were stored in a digital format
(DICOM) and transferred to a personal computer for
further analysis. Stat istical analyses were per formed
using ... full metal jacket bullets.
Infiltration depth of barium titanate particles in the
temporary cavity
The radiological examination of the infiltration depth...