... GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGT...
Ngày tải lên: 18/02/2014, 13:20
... distribu- tion and require supervised /semi-supervised infor- mation for learning. We propose a flexible genera- tive model for transliteration mining usable for both unsupervised and semi-supervised ... super- vised and semi-supervised systems we mentioned, our model can be used for both unsupervised and semi-supervised mining in a consistent way. 3 Unsupervi...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot
... files for providing a grammatical analysis of -n~estricted English text. From 1981-83, a suite of PASCAL programs was devised to automatically produce a single level of grammatical description ... automatically. The remaining 3 to ~ per cent were corrected by human post-editors. ~brk is now in progress to devise a suite of programs to provide a constituent...
Ngày tải lên: 22/02/2014, 09:20
Báo cáo khoa học: "A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Features in Chinese Text Categorization" potx
... Abstract Words and character-bigrams are both used as features in Chinese text process- ing tasks, but no systematic comparison or analysis of their values as features for Chinese text categorization ... 2006. c 2006 Association for Computational Linguistics A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Featu...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants" docx
... Linguistics A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants Rashid M. Abdalla and Simone Teufel Computer Laboratory, University of Cambridge 15 JJ Thomson Avenue, Cambridge CB3 OFD, ... investigate the unsupervised detection of semi-fixed cue phrases such as “This paper proposes a novel approach. . . 1 ” from unseen text, on the basis of o...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous expression of the P450scc system; they also amplify and extend recent information on an active P450scc ... 353 4184 A. Slominski et al.(Eur. J. Biochem. 271) Ó FEBS 2004 A novel pathway for sequential transformation of 7-dehydrocholesterol and expression...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... on the point estimation of words’ context profiles obtained from a limited amount of data. This paper proposes a Bayesian method for robust distributional word similarities. The method uses a ... calculation of distributional similarity. The method is straightforward: Instead of using the point estimation of v(w i ), we first estimate the distribution of the cont...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: "A Structured Model for Joint Learning of Argument Roles and Predicate Senses" pot
... F P Plemma of the predicate and predicate s head, and ppos of the predicate Dependency label between the predicate and predicate s head The concatenation of the dependency labels of the predicate s ... between the predicate and the argument candidates The number of dependency edges between the predicate and the argument candidate F P A Plemma and plemma&...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... is the first time the biosensor assay for MAP has been demonstrated. Materials and Methods Bacterial strain and growth Mycobacterium avium subsp. paratuberculosis- 66115-98, a clinical isolate ... study indicated that the lateral flow biosensor assay was effective, even in the detection of 10 MAP organisms in the spiked fecal samples. Apart from the...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... knowledge, represents the first in the literature describing a multidisciplinary approach for the successful management of a large metastasic GIST to the liver. We attribute the success of this case to ... with a history of a bowel resection 7 years prior for a primary GIST of the small bowel. The finding of a heterogeneous mass 15.5 cm in diameter replaci...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo khoa hoc:" A repetitive probe for FISH analysis of bovine interphase nuclei" doc
... 555–560. [8] de Sario A. , Vagnarelli P., De Carli L., Aneuploidy assay on diethylstilbestrol by means of in situ hybridization of radioactive and biotinylated DNA probes on interphase nuclei, Mutat. Res. ... 83–690. [18] Iwasaki S., Hamano S., Kuwayama M., Yamashita M., Ushijima H., Na- gaoka S., Nakahara T., Developmental changes in the incidence of chromosome ab- normalities of...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:" A sampling algorithm for segregation analysis" ppt
... D.B., Bayesian Data Analysis, Chap- man and Hall, London, 1995. [6] Geman S., Geman D., Stochastic relaxation, Gibbs distribution and the Bayesian restoration of images, IEEE Transactions on Pattern ... data are available on others, as is the case for genetic disorders, is more complicated and is addressed in a separate paper [10]. When all genotypes are unknown any randomly drawn descent...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:"A higher resolution radiation hybrid map of bovine chromosome 13" docx
... into the evolutionary development of the chromosome as compared to man. bovine chromosome 13 / radiation hybrid / gene mapping / 12 000 rad / comparative mapping ∗ Correspondence and reprints E-mail: ... Taylor J.F., Cytogenetic alignment of the bovine chromosome 134 genome map by fluorescence in situ hybridization of human chromosome 10 and 20 comparative markers, C...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... Lightspeed, USA) at 120 kV and 200 mA. Analysis The data obtained were stored in a digital format (DICOM) and transferred to a personal computer for further analysis. Stat istical analyses were per formed using ... full metal jacket bullets. Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth...
Ngày tải lên: 11/08/2014, 20:21