Báo cáo khoa hoc:" Variance component analysis of skin and weight to sheep subjected rapid inbreeding ppsx

... routinely used assay is the hemagglutination assay [4], where the ability of a given virus to bind to and agglutinate red blood cells (RBCs) is measured. In the case of influenza, for example, the hemagglu- tination ... cRBCs. Defining the glycans present on the surface of cRBCs will allow either for the design of strategies to optimize the agglutination ass...

Ngày tải lên: 14/02/2014, 19:20

... dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the linguistic contri- bution of morphemes greatly differ according to their types of origin. To ... different according to their types of origin, i.e. the morphemes borrowed mainly from Western languages (borrowed morphemes) and the native morphemes including Chinese- ori...

Ngày tải lên: 20/02/2014, 18:20

... technique of elementary modes analysis. The technique is applied to a model of chloroplast metabolism to investigate viable pathways in the light, in the dark, and in the dark with the addition of sedoheptulose-1,7-bisphosphatase ... sedoheptulose- 1,7-bisphosphatase. Discussion One of the original goals motivating this structural inves- tigation of the...

Ngày tải lên: 20/02/2014, 23:20

... into the causes of the distinct behavior of daunorubicin and WP631, we compared the intracellular accumulation of these com- pounds in Jurkat T cells overtime. We also examined the rate and overall ... analysis of lysates of cells treated with either drug. Daunorubicin was captured by the cells more rapidly, and in a greater amount, than WP631 at any time...

Ngày tải lên: 20/02/2014, 23:20

... discharged nematocyst to prey or to the substrate. Spinalin is a 24-kDa pro- tein that is a constituent of spines and opercula of Hydra nematocysts [3]. Immunocytochemical analysis of developing nematocysts ... the Golgi apparatus. During this process, the external tubule is assembled at the apical end of the capsule and in a later stage invag- inates into the capsule ma...

Ngày tải lên: 07/03/2014, 12:20

... et al. Cuticular proteins in horseshoe crabs FEBS Journal 272 (2005) 47744786 ê 2005 FEBS 4785 and DE29 is involved in chitin binding. In insects, cuticular proteins containing cysteine residues ... microorganisms [28,29]. In order to identify novel cuticular chitin-bind- ing proteins and cuticular proteins involved in innate immunity, we undertook an extensiv...

Ngày tải lên: 07/03/2014, 21:20

... Hb-HN Ó FEBS 2002 NMR structure of Schistocerca inhibitors (Eur. J. Biochem. 269) 533 Comparative structure analysis of proteinase inhibitors from the desert locust, Schistocerca gregaria Zolta  nGa  spa  ri 1 , ... increased ¯exibility of the proteinase- binding loop compared to the rest of the molecules agree well with the đndings obtained f...

Ngày tải lên: 08/03/2014, 10:20

... Complex noun sequences. Semantic patterns in complex noun phrases fall into two types: part names and other noun phrases. Names for pieces of equipment often con- tain complex noun sequences, ... Complex noun sequences. A major feature of noun phrases in this set of messages is the presence of many long sequences of left modifiers of nouns, (3). {3) (a...

Ngày tải lên: 08/03/2014, 18:20

... Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change TGA–TCC in T69 (kid T69G) Analysis of Kid RNase ... ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid D75N) PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change A...

Ngày tải lên: 16/03/2014, 03:20

... Structure–function analysis of the filamentous actin binding domain of the neuronal scaffolding protein spinophilin Herwig Schu ă ler 1, * and Wolfgang ... studies of the actin binding domain of spinophilin. We demonstrate that the spinophilin actin binding domain is intrinsically unstructured, and that, with increasing C-terminal length, t...

Ngày tải lên: 16/03/2014, 06:20

... GdnHCl concentrations (B) during unfolding (s) and refolding of HSA (d). HSA (2 l M ) in the absence of GdnHCl was used as the control. Ó FEBS 2004 Mechanism of folding and unfolding of HSA (Eur. J. Biochem. ... folding and unfolding pathways of human serum albumin Evidence for a framework mechanism of folding Manas Kumar Santra, Abhijit Banerjee, Shyam S...

Ngày tải lên: 16/03/2014, 16:20

... 2003 In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional group I intron-encoded protein, I-AniI William J. Geese, Yong K. Kwon, Xiaoping Wen and ... of endonuclease activity and inhibition of splicing activity indicating that RNA binding can be monitored by meas- uring inhibition of the endonucleas...

Ngày tải lên: 17/03/2014, 10:20

... protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate Judit Marokha ´ zi 1 , Nikolett Mihala 2 , Ferenc Hudecz 2,3 , Andra ´ s ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on th...

Ngày tải lên: 23/03/2014, 09:20

... ! 0.20. The effect of the inbreeding of the dam Original article Variance component analysis of skin and weight data for sheep subjected to rapid inbreeding Frank H. Shaw J.A. ... dominance variance was estimated to be of a similar magnitude to additive and to environmental variance, depression to complete inbreeding was of...

Ngày tải lên: 09/08/2014, 18:21

... practice upgrading of physicians. Identifying and indexing barriers and facilitators to auditing complica- tions and the level of practice of physicians would facili- tate implementation of quality ... Québec, Canada. 5 Department of Medicine, Université Laval, Québec, Canada. 6 Canadian Partnership Against Cancer, Québec, Canada. 7 University of Calgary, Calgary, Al...

Ngày tải lên: 10/08/2014, 10:23