Báo cáo khoa hoc:" Mixed effects linear models with t-distributions for quantitative" docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

... that includes a DNA-binding domain, a ligand-binding domain and a transactivation domain. The DNA-bind- ing domain is responsible for DNA binding specificity and dimerization, and the ligand-binding ... ê 2010 FEBS MINIREVIEW Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing Khairul I. Ansari and Subhrangsu S. Mandal Depart...

Ngày tải lên: 16/02/2014, 14:20

15 607 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

... directed towards histone H3 lysine 4 methylation and the enzymes involved in this covalent modification in eukaryotes ranging from yeast to human. These studies revealed a set of histone H3 lysine 4 ... CREB-binding protein; EcR, ecdysone receptor; HAT, histone acetyl transferase; H3K4, histone H3 lysine 4; HMT, histone methyltransferase; MLL, mixed lineage...

Ngày tải lên: 16/02/2014, 14:20

17 665 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf

... proteins. Thus, the MEN1 ⁄ LEDGF-interacting domain linked to DNA-binding domains (AT-hook and MT domain) becomes disconnected from the PHD domains, the FYRN domain, the transactivating domain, ... compilation ê 2010 FEBS MINIREVIEW Mixed lineage leukemia: roles in human malignancies and potential therapy Rolf Marschalek Biochemistry, Chemistry & Pharmacy, Institute...

Ngày tải lên: 16/02/2014, 14:20

10 658 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... 1841 of cell fate. Leukemias associated with loss -of- function or gain -of- function variants of MLL1 are prime exam- ples of the importance of maintaining the enzymatic activity of MLL1 under tight ... MINIREVIEW Mixed lineage leukemia: a structure–function perspective of the MLL1 protein Michael S. Cosgrove and Anamika Patel Department of Biology, S...

Ngày tải lên: 16/02/2014, 14:20

11 762 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... the involvement of DNA gyrase in the antimicrobial effects of H4-(8 6–1 00) and related compounds was obtained in vitro by the mea- surement of their inhibitory activity on the supercoiling of pBR322 ... those of the inactive antimicrobial fragments HNb-( 1–1 3) and HNb-( 3–1 3) (Table 2) were not signifi- cant (Fig. 6B). The antimicrobial and anti -DNA...

Ngày tải lên: 18/02/2014, 14:20

12 756 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... presence of E2. Binding of ERa and ERb was increased in both ERE1 and ERE2 of the HOXC13 promoter (Fig. 5A, lanes 1–4). The levels of E2-induced binding of ERa and ERb were higher in ERE2 than in ERE1. ... E2-dependent binding of any of the MLLs⁄ ERs, indicating no significant roles of these EREs in HOXC13 activation (Fig. 5A). To further confirm the E2-dependent b...

Ngày tải lên: 18/02/2014, 14:20

12 519 0
Tài liệu Báo cáo khoa học: "Mixing Multiple Translation Models in Statistical Machine Translation" docx

Tài liệu Báo cáo khoa học: "Mixing Multiple Translation Models in Statistical Machine Translation" docx

... and Alfons Juan. 2007. Domain adap- tation in statistical machine translation with mixture modelling. In Proceedings of the Second Workshop on Statistical Machine Translation, StatMT ’07, pages 177–180, ... 2010. Discriminative instance weighting for domain adapta- tion in statistical machine translation. In Proceedings of the 2010 Conference on Empirical Methods in...

Ngày tải lên: 19/02/2014, 19:20

10 456 0
Báo cáo khoa học: "Training Phrase Translation Models with Leaving-One-Out" ppt

Báo cáo khoa học: "Training Phrase Translation Models with Leaving-One-Out" ppt

... have shown that training phrase models can improve translation performance on a state-of- the-art phrase- based translation model. This is achieved by training phrase translation probabil- ities ... learn phrase translation probabilities for phrase- based statistical machine translation that go beyond pure counting of phrases in word-aligned training data. Most approaches...

Ngày tải lên: 07/03/2014, 22:20

10 391 0
Báo cáo khoa học: " Extending Latent Semantic Analysis with features for dialogue act classification" pot

Báo cáo khoa học: " Extending Latent Semantic Analysis with features for dialogue act classification" pot

... of other dialogue related features, such as Game, to classify DAs. The drawback of features such as Game is that FLSA: Extending Latent Semantic Analysis with features for dialogue act classification Riccardo ... (Kintsch, 2001). We will show that for our task, dialogue act classification, syntactic features do not help, but most dialogue related features do....

Ngày tải lên: 08/03/2014, 04:22

8 409 0
Báo cáo khoa học: "Forest Reranking: Discriminative Parsing with Non-Local Features∗" docx

Báo cáo khoa học: "Forest Reranking: Discriminative Parsing with Non-Local Features∗" docx

... Ohio, USA, June 2008. c 2008 Association for Computational Linguistics Forest Reranking: Discriminative Parsing with Non-Local Features ∗ Liang Huang University of Pennsylvania Philadelphia, PA ... 2 6 ). Alternatively, discriminative parsing is tractable with exact and efficient search based on dynamic programming (DP) if all features are restricted to be local, that is, only...

Ngày tải lên: 17/03/2014, 02:20

9 315 0
Báo cáo khoa học: "Beyond Log-Linear Models: Boosted Minimum Error Rate Training for N-best Re-ranking" docx

Báo cáo khoa học: "Beyond Log-Linear Models: Boosted Minimum Error Rate Training for N-best Re-ranking" docx

... 37–40, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics Beyond Log-Linear Models: Boosted Minimum Error Rate Training for N-best Re-ranking Kevin Duh ∗ Dept. of Electrical ... algorithms for machine translation rely on log-linear models, which have the potential problem of underfitting the training data. We present BoostedMERT, a novel...

Ngày tải lên: 23/03/2014, 17:20

4 239 0
Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

... preferential treatment, E(Di!), increased with or2 h, as illustrated in table I. Original article Attenuating effects of preferential treatment with Student-t mixed linear models: a ... clearly inappropriate. It appears that some robust linear models can handle preferential treatment of animals better than the standard mixed effect...

Ngày tải lên: 09/08/2014, 18:21

19 302 0
Báo cáo khoa hoc:" Mixed effects linear models with t-distributions for quantitative" docx

Báo cáo khoa hoc:" Mixed effects linear models with t-distributions for quantitative" docx

... machinery of mixed effects linear models can be exploited. An appealing alternative is to fit linear models with robust distributions for the errors and for the random effects. ... AU2 /82 ) process with s2 wu N X2. Iv,,. The augmented joint posterior density is Original article Mixed effects linear models with t-distributions f...

Ngày tải lên: 09/08/2014, 18:21

18 207 0
Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx

Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx

... beneficial effects of EPO in preclinical models of shock, trauma and haemorrhage are exciting, but further studies are warranted to determine the effects of EPO on outcome (organ injury/dysfunction and ... antioxidant and anti-inflammatory effects of EPO, which have been reported in other models of disease [11]. Thus, the beneficial effects of EPO in ro...

Ngày tải lên: 13/08/2014, 03:21

2 174 0
w