Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

... covariance functions are the ’infinite-dimensional’ equivalent to covariance matrices in a traditional, ’finite’ multivariate analysis [15]. As the name indicates, a covariance ... the covariance matrices for the ages in the data generated by the estimated CFs are equal to the estimates that would have been obtained in a conventional, m...

Ngày tải lên: 09/08/2014, 18:21

... increased character accuracy to the relat ive increased MAP for the three lexicon adaptation ap- proaches are different. A key factor making the proposed LAICA approach advantageous is that we ... parts randomly: 5K as the adaptation corpus and 5K as the testing set. We show the ASR char- acter accuracy results after lexicon adaptation by the proposed approach in Table 3. LAICA-1 LAICA-2...

Ngày tải lên: 20/02/2014, 07:20

... require any additional annotated data other than the data that a regular translation system uses. We integrate our method in to a state-of- the-art baseline translation system and show that it ... full-form as a bridge. Our method is scalable enough to handle large amount of monolingual data, and is essentially unsupervised as it does not require any additional annotated data tha...

Ngày tải lên: 20/02/2014, 09:20

... DNA, includ- ing a C-terminal HA tag, using primers 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ ... phosphatase and 4-acetamido-4¢-maleim- idylstilbene-2,2¢-disulfonic acid disodium salt (AMS) were purchased from Invitrogen (Carlsbad, CA, USA). Antise- rum against influenza haemagglutinin (HA) wa...

Ngày tải lên: 07/03/2014, 02:20

... summaries, and what type (variety) of summaries should be prepared? Kazawa et al. prepared 6 summaries for each document, and Yasuda et al. prepared 29 translations for each conversation. However, ... been evaluated manually. There are two research studies related to our work (Kazawa et al., 2003, Yasuda et al., 2003). Kazawa et al. (2003) proposed an automatic evaluation method...

Ngày tải lên: 17/03/2014, 04:20

... to thank to Xerox for letting us using their tools, and also to Lauri Karttunen for his help. References Aduriz I., Alegria I., Artola X., Ezeiza N., Sara- sola K., Urkia M. (1997), A spelling ... morphemes: behar (using a rule to guess the h), tze and tikan. • tikan is a non-standard use of tik and as they are linked in the lexicon is chosen. * The standard gene...

Ngày tải lên: 17/03/2014, 23:20

... Echizen-ya, Terumasa Ehara, Sayori Shi- mohata, Atsushi Fujii, Masao Utiyama, Mikio Yamamoto, Takehito Utsuro and Noriko Kando. 2009. Meta-Evaluation of Automatic Evaluation Methods for Machine Translation ... 9-Chome, Kita-ku, Sapporo, 060-0814 Japan araki@media.eng.hokudai.ac.jp Abstract As described in this paper, we propose a new automatic evaluation method for machine translation...

Ngày tải lên: 23/03/2014, 16:20

... Naar, A. M., Beaurang, P .A. , Zhou, S., Abraham, S., Solomon, W. & Tjian, R. (1999) Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature 398,832. 18. Naar, ... reconstituted assay using the RNAPII holoenzyme and found that Gal4-CTF is able to activate basal transcription (Fig. 5E, compare lanes 1, 2, and 3) whereas Gal4-SP1 is not (compare lanes 1,...

Ngày tải lên: 30/03/2014, 14:20

... COLING-ACL’98. Yusuke Miyao, Takaki Makino, Kentaro Torisawa, and Jun-ichi Tsujii. 2000. The LiLFeS abstract machine and its evaluation with the LinGO gram- mar. Natural Language Engineering, 6(1):47 ... robust. For topical nouns and POSs, we used the GENIA corpus (Kim et al., 2003), a corpus of annotated ab- stracts taken from National Library of Medicine’s MEDLINE database. We defined to...

Ngày tải lên: 31/03/2014, 03:20

... discussion and data analysis. TH participated in data analysis and manuscript writing. All the authors read and approved the final manuscript. Competing interests The authors declare that they have ... IORT. Keywords: intraoperative radiotherapy, IORT, cervical metastasis Background The management of advanced or recurrent cervical node metastases poses a challenge for surgeons and rad...

Ngày tải lên: 09/08/2014, 09:20