Báo cáo y học: "Measuring metacarpal cortical bone by digital x-ray radiogrammetry: a step forward" pot

... estimated by early radiological joint damage. Juxta- articular bone loss and subchondral bone oedema due to the replacement of marrow fat by heavily vascularised inflammatory cells are the earliest ... which RA patients will have a favourable response to conventional (methotrexate, or MTX) therapy? And what are the characteristics of RA patients with an unfavourable prognosis, estim...

Ngày tải lên: 09/08/2014, 14:22

... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ... Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 and AB034952), Arabidopsis thali- ana (At phyA and -C) and Solanum tuberosum (St phyA and -B). Grey boxes: amino acids iden...

Ngày tải lên: 08/03/2014, 23:20

... random hexamer (Pharmacia, Uppsala, Sweden). The PCR primer sequences used were as follows. FasL (forward: 5¢-ATGTTTCAGC TCTTCCACCTACAGAAGGA-3¢,reverse:5¢-CAGAGA GAGCTCAGATACGTTGAC-3¢); and b-actin ... the cytoplasm [19,39]. While NFAT dephosphorylation is mediated by calcineurin, rephosphorylation is catalyzed by a variety of serine kinases, such as glycogen synthase kinase- 3, ERK, p3...

Ngày tải lên: 24/03/2014, 03:21

... respectively)[12]. Conclusion Markedly elevated IgE may rarely present as an initial manifestation of a lymphoproliferative disorder such as a lymphoma. These patients may be referred for evaluation of allergy or immunodeficiency, ... however a marked elevation of IgE as an ini- tial manifestation of a lymphoproliferative disease is rare, and mainly reported in IgE producing plasmacyt...

Ngày tải lên: 08/08/2014, 21:20

... relatively contra- indicated during allergy skin testing. The American Academy of Allergy Asthma & Immunology (AAAAI) outlines t his in its position statement, stating that “Sys- temic reactions ... beta-blockade may place atopic subjects at an increased risk of an anaphylactic reaction. Case reports suggest tha t whe n systemic allergic reactions occur sec- ondary to immunotherapy, drugs...

Ngày tải lên: 08/08/2014, 21:20

... 5:9 http://www.jbppni.com/content/5/1/9 Page 3 of 4 neuropathy) and coronary angiography (1 median neu- ropathy contralateral to the side of arterial cannulation). Sciatic neuropathies due to hip arthroplasty (12/36: 33.3%) accounted ... neuropathy in these patients in this study was underlying chronic renal fail- ure, as all patients having AVFs formed were for renal dialysis therapy. A la...

Ngày tải lên: 10/08/2014, 10:20

... deposited directly by the metaplastic myoepithelial cells rather than by endochondral ossification. Hamakawa et al. [6] noted that bone tissue in pleomorphic adenoma was formed mainly by direct deposition ... Head and Neck Tumours. Lyon: IARC Press; 2005: 254-258. 2. Arai Y, Sakuma Y, Yokozawa S, Uchida M, Fujita H, Nonaka H. A case of pleomorphic adenoma with remarkable bon...

Ngày tải lên: 08/08/2014, 16:23

... observational databanks results from potential bias in assignment of treatment by a physician. ‘Confounding by indication’ means that certain treatments are preferentially given to sicker patients ... by pharmaceutical industry, which has set up several surveillance databanks. In addition to monitor- ing for safety, these databanks collect information that has potential business appli...

Ngày tải lên: 09/08/2014, 01:23

... Saclay, France). Gene array analysis Quantification was performed using the AtlasImage software (BD Biosciences). Data from each array were normalized by the median value to eliminate the variability ... appropriate according to data distribution. All data were analyzed by the program Instat (Graphpad, San Diego, CA, USA). Results Phenotypic characterization Adherent cells isolated from B...

Ngày tải lên: 09/08/2014, 07:20

... Miyazaki T, Koshihara Y, Oda H, Nakamura K, Tanaka S: Involvement of receptor activator of nuclear factor kappaB ligand/osteoclast differentiation factor in osteoclastogenesis from synoviocytes in ... bone resorption mediated by osteoclasts as well as bone formation exerted by osteoblasts. Chronic inflammation can lead to sustained alterations of bone turnover, as typically seen in...

Ngày tải lên: 09/08/2014, 07:20