Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
Báo cáo y học: "Association of common polymorphisms in known susceptibility genes with rheumatoid arthritis in a Slovak population using osteoarthritis patients as control" doc
... criteria for the classifi-
cation of rheumatoid arthritis. Arthritis Rheum 1988,
31:315-324.
14. Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka
M, Sudo A, Uchida A, Yamamoto ... Yamamoto S, Ozaki K, Takigawa M, Tanaka
T, Nakamura Y, Jiang Q, Ikegawa S: A functional polymorphism
in the 5' UTR of GDF5 is associated with susceptibility to oste-
oarthri...
Báo cáo y học: "Effect of adalimumab on neutrophil function in patients with rheumatoid arthritis" pps
... pathogenensis of
rheumatoid arthritis (RA). Therefore, these cells may be among
the targets of anti-TNF-α therapy. In this study we evaluated the
effect of therapy with adalimumab (a fully human anti-TNF-α
mAb; ... fluorescence of cells
incubated with irrelevant isotype control mAbs.
Statistical analysis
Data are expressed as mean ± standard error of the mean.
Statistical analy...
Báo cáo y học: "Stress of different types increases the proinflammatory load in rheumatoid arthritis" docx
... as
rheumatoid arthritis (RA) stimulates proinflammatory mechanisms
due to the defect of stress response systems (for example, the
sympathetic nervous system and the hypothalamic–pituitary–
adrenal axis). ... steadily
increases, and today we can say that patients with chronic
inflammatory diseases such as rheumatoid arthritis (RA) show
abnormal stress responses leading to proinflamm...
Báo cáo y học: "Analysis of skewed X-chromosome inactivation in females with rheumatoid arthritis and autoimmune thyroid disease" docx
... Shiozawa S, Hayashi S, Tsukamoto Y, Goko H, Kawasaki H, Wada
T, Shimizu K, Yasuda N, Kamatani N, Takasugi K, Tanaka Y, Shio-
zawa K, Imura S: Identification of the gene loci that predispose
to rheumatoid ... University,
Ankara, Turkey approved the study protocol.
Methods
Autoantibodies analysis
In AITDs patients, thyroid autoantibodies (anti-thyroglobulin
and anti-thyroid peroxydase) we...
Báo cáo y học: "Hand bone loss as an outcome measure in established rheumatoid arthritis: 2-year observational study comparing cortical and total bone loss" pot
... only
takes place in the first 3 years of disease duration [7].
Table 1
Patient characteristics at baseline and at 2-year follow-up
Variable n Baseline At 2-year follow-up
Demographic
Age (years) ... measures that may
reflect bone quality; dual-energy X-ray absorptiometry (DXA),
which measures total cortical and trabecular bone; and digital
X-ray radiogrammetry (DXR), which measures cortical...
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
... previously shown to have good construct validity and
moderate convergent validity with the DAS28 [16,17].
Because health care utilisation databases are a valuable
source of data for studying health ... health care utilisation data indicators of RA
severity
We extracted the following information from the VA data-
bases: rehabilitation visits (physical and occupational th...
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... SDS/PAGE. Autoradio-
graphy was carried out on a BAS-IP NP 2040P imaging
plate. Radioactivity was monitored with a Fujix BAS 2000
scanner (Raytest, Straubenhardt). Gel documentation was
accomplished ... Germany;
2
Institute for Molecular Biosciences, The University of Queensland, St Lucia,
Australia
A novel photoactivatable analog of antisauvagine-30 (aSvg-
30), a specific antago...
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA)
and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele-
specific primer s Pnf (AGCATTTGGTTTTAAATTATG-
GAGTATATG) and Pmr (GTTTTACTTACTCTCGT
CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S,
Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K,
Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary
myelofibrosis a...
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the
leg from a warty acral amelanotic malignant melanoma. Eur J Dermatol
2001, 11:591-592.
37. Fountain JA: Recognition of subungual ... and consequences of physician delay in the diagnosis of acral
melanoma. Melanoma Res 1998, 8:181-186.
41. Lemont H, Brady J: Amelanotic Melanoma Masquerading as an Ingrown
Toenail....
Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
... anti-inflammatory
agents, non steroidal anti-inflammatory) and AMI (for instance,
myocardial infarction, myocardial ischemia, cardiac ischemia,
death) were combined to capture all potentially ... myocardial infarction; BMI, body mass index; CABG, coronary artery bypass grafting; CAD, coronary artery disease; CCF, congestive
cardiac failure; CHD, coronary heart disease; COX, cyclo-oxygenase...
Từ khóa: