... criteria for the classifi- cation of rheumatoid arthritis. Arthritis Rheum 1988, 31:315-324. 14. Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto ... Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A functional polymorphism in the 5' UTR of GDF5 is associated with susceptibility to oste- oarthri...
Ngày tải lên: 09/08/2014, 14:20
... pathogenensis of rheumatoid arthritis (RA). Therefore, these cells may be among the targets of anti-TNF-α therapy. In this study we evaluated the effect of therapy with adalimumab (a fully human anti-TNF-α mAb; ... fluorescence of cells incubated with irrelevant isotype control mAbs. Statistical analysis Data are expressed as mean ± standard error of the mean. Statistical analy...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Stress of different types increases the proinflammatory load in rheumatoid arthritis" docx
... as rheumatoid arthritis (RA) stimulates proinflammatory mechanisms due to the defect of stress response systems (for example, the sympathetic nervous system and the hypothalamic–pituitary– adrenal axis). ... steadily increases, and today we can say that patients with chronic inflammatory diseases such as rheumatoid arthritis (RA) show abnormal stress responses leading to proinflamm...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: "Analysis of skewed X-chromosome inactivation in females with rheumatoid arthritis and autoimmune thyroid disease" docx
... Shiozawa S, Hayashi S, Tsukamoto Y, Goko H, Kawasaki H, Wada T, Shimizu K, Yasuda N, Kamatani N, Takasugi K, Tanaka Y, Shio- zawa K, Imura S: Identification of the gene loci that predispose to rheumatoid ... University, Ankara, Turkey approved the study protocol. Methods Autoantibodies analysis In AITDs patients, thyroid autoantibodies (anti-thyroglobulin and anti-thyroid peroxydase) we...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Hand bone loss as an outcome measure in established rheumatoid arthritis: 2-year observational study comparing cortical and total bone loss" pot
... only takes place in the first 3 years of disease duration [7]. Table 1 Patient characteristics at baseline and at 2-year follow-up Variable n Baseline At 2-year follow-up Demographic Age (years) ... measures that may reflect bone quality; dual-energy X-ray absorptiometry (DXA), which measures total cortical and trabecular bone; and digital X-ray radiogrammetry (DXR), which measures cortical...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
... previously shown to have good construct validity and moderate convergent validity with the DAS28 [16,17]. Because health care utilisation databases are a valuable source of data for studying health ... health care utilisation data indicators of RA severity We extracted the following information from the VA data- bases: rehabilitation visits (physical and occupational th...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... SDS/PAGE. Autoradio- graphy was carried out on a BAS-IP NP 2040P imaging plate. Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt). Gel documentation was accomplished ... Germany; 2 Institute for Molecular Biosciences, The University of Queensland, St Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antago...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty acral amelanotic malignant melanoma. Eur J Dermatol 2001, 11:591-592. 37. Fountain JA: Recognition of subungual ... and consequences of physician delay in the diagnosis of acral melanoma. Melanoma Res 1998, 8:181-186. 41. Lemont H, Brady J: Amelanotic Melanoma Masquerading as an Ingrown Toenail....
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
... anti-inflammatory agents, non steroidal anti-inflammatory) and AMI (for instance, myocardial infarction, myocardial ischemia, cardiac ischemia, death) were combined to capture all potentially ... myocardial infarction; BMI, body mass index; CABG, coronary artery bypass grafting; CAD, coronary artery disease; CCF, congestive cardiac failure; CHD, coronary heart disease; COX, cyclo-oxygenase...
Ngày tải lên: 09/08/2014, 08:22