Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx

... Nakamura K, Tokunaga Y, Hanada S, Kumemura H, Maeyama M, Harada M, Ogata H, Yano H, Kojiro M, Ueno T, Yoshimura A, Sata M: Spreds, inhibitors of the Ras/ERK signal transduction, are dysregulated ... GGCCTGTTTGGCACTATGTGA LOC309362 Dnmbp 16 Exiqon Universal probe 97 TTGTCTCAGCATGGGTCCTA ACCAGGATTTTAAGGCCACA NM_001107408 Gins3 3–4 Exiqon Universal probe 17 GTCGTGGACCTCCACAAAAT GAACCGTCCAATAA...

Ngày tải lên: 09/08/2014, 10:23

... emergency medical call centre organization reform in Finland. Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of southern Finland ... were calculated by logistic regression. Probability that was the same or below 0.01 was accepted as statistically significant. Results A total of 67 610 emergency calls were analyzed, a...

Ngày tải lên: 25/10/2012, 10:02

... 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras- buricase, according to the various clinical states, the type of malignancy and drugs ... University of Catania, Catania, Italy Correspondence to: Mariano Malaguarnera, A. P., Via Messina 829 – 95125 Catania (Italy). Phone ++39 95 7262008; Fax ++39 95 7262011; E-Mail: malaguar@un...

Ngày tải lên: 31/10/2012, 14:59

... 10.1186/1744-859X-9-25 Cite this article as: Cocchi et al., Human depression: a new approach in quantitative psychiatry Annals of General Psychiatry 2010, 9:25 Cocchi et al. Annals of General Psychiatry 2010, 9:25 http://www.annals-general-psychiatry.com/content/9/1/25 Open ... intracellular event (for example, activation of adenylate cyclase). Cocchi et al. Annals of General Psychiatry...

Ngày tải lên: 08/08/2014, 23:21

... blockade for 14 days in a patient with rheumatoid arthritis (haematoxylin–eosin staining; original magnification ×400). After active treatment there was a marked reduction in synovial cellularity, ... sclerosis, transplant rejection and inflammatory bowel disease [4]. Analysis of synovial tissue, synovial fluid and peripheral blood from patients with rheumatoid arthritis (RA) revealed abu...

Ngày tải lên: 09/08/2014, 01:23

... lysine sidechains undergo acetylation, through the action of histone acetyltransferases, by way of acetyl coenzyme A, a step which is associated with transcriptional activation. These modifications ... metalloproteinases. Available online http://arthritis-research.com/contents/7/4/155 Abstract Increased expression of metalloproteinases is a fundamental aspect of arthritis pathology and...

Ngày tải lên: 09/08/2014, 06:23

... heterogeneous data sets [8]. This particular study tried to match disease complexity of patient infor- mation, clinical data, standard laboratory evaluations, brain imaging data and genetic data obtained ... health- care, enable researchers to search online biological databases and use bioinformatics in medical practice, select appropriate software to analyze the microarray data for medical d...

Ngày tải lên: 10/08/2014, 09:22

... one- year period. Statistical Analyses Part One. Functional Movement Screen Data was coded using Stata 8.0. For exploratory data anal- ysis we used bivariate methods. The primary hypothesis was assessed ... 3 Lunda and Associates, 1636 North Swan, Tucson, Arizona, USA Email: WF Peate* - peate@email.arizona.edu; Gerry Bates - Gerry.Bates@tucsonaz.gov; Karen Lunda - k.lunda@worldnet.att.net;...

Ngày tải lên: 20/06/2014, 00:20

... from the American Type Culture Collection (ATCC, Manassas, VA) and treated as described for primary chondrocytes. Northern hybridization analysis Total cellular RNA was extracted by the guanidinium ... factor. J Biol Chem 2000, 275:1708-1714. 29. Kardassis D, Papakosta P, Pardali K, Moustakas A: c-Jun transac- tivates the promoter of the human p21(WAF1/Cip1) gene by acting as a superacti...

Ngày tải lên: 09/08/2014, 06:22

... Repositories. Methylation d ata were obtained using the Illumina HumanMethylation27 DNA Analysis BeadChip assay. Methylation estimates were assayed using two technical replicates per individual and methylation levels ... stochastic and environmental factors are also likely to play an important role [2,14]. Recent work indicates that genetic variation may have a substantial impact on local m...

Ngày tải lên: 09/08/2014, 22:23