Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... Sense: GGAAACTTTGCTGCCCAGATG 710–876 167
Antisense: TCACCAGGTTCACCAGGATTGC
AGN, aggrecan; ALP, alkaline phosphatase; COL 2A1 , collagen type II α1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ... 4
Research article
Human palatine tonsil: a new potential tissue source of
multipotent mesenchymal progenitor cells
Sasa Janjanin
1,2
*, Farida Djouad
1
*, Rabie M Shanti
1...
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... transcript
(7 kb) harbors five polyadenylation sites (two AATAAA,
and three AATTAAA), nine ATTTA sequences [23], two
Alu-repeats and three CAGAC motifs [24].
BLAST
searches revealed the homology ... post-translational phos-
phorylation and palmitoylation [40]. Only a small subset of
spry1 was recruited to the plasma membrane as part of lipid
rafts upon cellular activation by VEGF, also c...
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424;
AD**, pACT2. Activity values are given as mean values ± standard deviation ... protein -A Sepharose,
washed and separated by SDS/PAGE. The immunostaining
of Western blot was performed by commercially available,
high affinity anti-(b-galactosidase) Ig.
Anti-(b-gal...
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot
... Masugi, F., Ogihara, T., Hasegawa, T., Sagakuchi, K. & Kuma-
hara, Y. (1988) Normalization of high plasma level of ouabain-
like immunoreactivity in primary aldosteronism after removal of
adenoma. ... gland
being a major place of synthesis and/or storage of ouabain,
adrenalectomy leads to a lowering of ouabain plasma levels
[18,29]. The adrenal cortex is likely to be the...
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... minutes and photographed in a
phase-contrast microscope (Ikaros System, Axiophot 2,
Carl Zeiss, Jena, Germany)
Flow Cytometry Analysis
Flow cytometry analysis was performed using a Guava
EasyCyte ... confirmed the mesenchymal nature of the
isolated cells and their multipotency.
Population doubling and karyotypic analysisFigure 2
Population doubling and karyotypic analysis. Panel A) R...
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... Central
Page 1 of 9
(page number not for citation purposes)
Journal of Circadian Rhythms
Open Access
Research
Preliminary evidence for a change in spectral sensitivity of the
circadian system at ... to visual targets are apparently low-
est just before dark and highest just before dawn [18].
Dacey et al. [19] have recently shown that in macaque
(and, therefore, probably in humans as...
Báo cáo y học: " Automated ERCC1 immunochemistry on hybrid cytology/tissue microarray of malignant effusions: evaluation of antibodies 8F1 and D-10." potx
... generate software
tools for automated analysis of TMA localization data and
XLM-based standardized data capture and transfer [31].
As presented on F igure 2, our h ybrid C/TMAs are likely
to be amenable ... ERCC1
immunochemistry on hybrid cytology /tissue microarray of malignant
effusions: evaluation of antibodies 8F1 and D-10. Journal of Clinical
Bioinformatics 2011 1:25.
Soltermann...
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt
... the
interaction was sufficient for affinity chromatography and
that the selectivity of the ligand was high.
Affinity recovery of IgA from human plasma
The potential use of the Z
IgA1
affibody as affinity ligand ... specificity analysis of the Z
IgA1
a body. Resulting
overlay sensorgrams from separate injections of 0.2 l
M
solutions of
human polyclonal IgA and IgA
1
,humanmyelomaIgA
2...
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... and fetal pancreas and in pancreatic tumoral
cell lines [35,36]. FAPP and BSSL are structurally closely
related, but are distinguished by a monoclonal antibody
directed towards a fucosylated epitope, ... fresh human milk samples as
previously described [31]. RNA hybridization was per-
formed essentially as described in Sambrook et al.[32].
Approximately 20 lg of each RNA preparation was...