... systematically mated and an inbred colony was established in 1920 [71]. The original BALB/c colony was separated in 1 935 . One of these colonies was maintained by G. Snell at The Jackson Laboratory ... littermates, and the composition of intestinal bacterial flora) maintained at different locations by the same vendor. Accord- ing to the online public database of The...
Ngày tải lên: 09/08/2014, 01:22
... incubated by an alkaline phosphatase conjugated rabbit anti-rat immu- noglobulin (Dako) and the reaction was visualized using a rat alkaline phosphatase–antialkaline phosphatase complex (Dako), ... and ERK in the synovial membrane, indicating that the intracellular effects of TNF can be inhibited. This suggests that anti-TNF therapy reduces key signalling pathways in the s...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "1, 25-dihydroxyvitamin D3 decreases adriamycin-induced podocyte apoptosis and loss"
... including Fas, FADD, Bax and Bcl-2 a n d caspase -3 activity were detected. Proteinuria can cause tubular cell apoptosis which is associated with activation of Fas-FADD-caspase 8 pathway (33 ) . Bcl ... aminonucleoside-induced apoptosis of glo- merular podocytes by activating the phosphatidyli- nositol 3- kinase/Akt- signaling pathway. Gassler et al. (12) revealed extensiv...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"
... activity of nitric oxide synthase. The increased activities of argininosuccinate synthetase and argininosuccinate lyase suggest the increased and effective recycling of citrulline to arginine in anoxia, ... in- volvement of NO in the pathophysiology of anoxia (hypobaric hypoxia) and reperfusion damage in brain. The increased activities of AS and AL indica...
Ngày tải lên: 26/10/2012, 09:07
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
... G 38 -H-K-S- G-H 43 by the corresponding sequences in LqhaIT were performed using the following oligonucleotides: 5¢-GGTTA TATTGCCAAGAACTATAACTGTGCATAC -3 ,5¢-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A -3 ,and5 ¢-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG -3 , ... that the highly variable and dynamic C-terminal tail together with the spatially vicinal residues, form the...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Matrilysin (matrix metalloprotease-7) cleaves membrane-bound annexin II and enhances binding of tissue-type plasminogen activator to cancer cell surfaces docx
... e-aminocaproic acid as a C-ter- minal lysine analog [27]. The kringle-2 domain of tPA directly interacts with e-aminocaproic acid [35 ]. Krin- gle-2-mediated tPA binding to the C-terminal lysines plays ... Abcam (Cambridge, MA, USA); rabbit polyclonal antibody against enolase, mouse mono- clonal antibody against annexin II and rabbit polyclonal antibody against annexin II from Santa...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: Na+/K+-ATPase as a signal transducer Zijian Xie and Amir Askari docx
... The signaling pathways that are rapidly elicited by the interaction of ouabain with Na + /K + -ATPase, and are independent of changes in intracellular Na + and K + concentrations, include activation of ... [Ca 2+ ] i regulates the signaling events initiated by ouabain. The Ca 2+ -calmodulin kinase also seems to be involved in ouabain-induced activation of MAPK and re...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... containing HA-tagged hspry4 was constructed. Kinase activity of cotransfected Myc-tagged MAP kinase was measured by its ability to phosphorylate myelin basic protein and was maximal 2 min after ... of 15 m M 3- amino-1,2,4-triazole and in the absence of the amino acids leucine, tryptophan and histidine. Full-length human TESK1 cDNA in pAct2, in frame with the GAL4 a...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "HIV-1 Capsid Assembly Inhibitor (CAI) Peptide: Structural Preferences and Delivery into Human Embryonic Lung Cells and Lymphocyte" pptx
... building blocks using the LEAP module of the AMBER package [30 ]. Linking of the two chains by forming a disulfide bond between the C-terminal cysteines and folding of the molecule into the starting ... search algorithm can be regarded as very high (see Material and Methods) and are clearly at the limit on what is technically feasible at the moment. The r...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "Subtyping patients with heroin addiction at treatment entry: factor derived from the Self-Report Symptom Inventory (SCL-90)" ppt
... the form of panic anxiety- related symptoms. Anxiety and panic anxiety may be linked with the withdrawal syndrome. The pathophysiol- ogy of withdrawal actually overlaps with that of panic dis- order, ... here, as are addi- tional somatic c signs (for example, 'trembling'). Scales measuring free-floating anxiety and panic attacks are an Maremmani et al. Annals of Ge...
Ngày tải lên: 08/08/2014, 23:21