Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
... cells, this threshold varies according to the susceptibility of thymocytes to death and the capacity of the T- cell receptor (TCR) and downstream pathways to transmit an activation signal. Moreover, ... interaction with TNF receptor 1 and the TNF receptor 1-associated death domain. Activation bypasses the cytoplasmic TNF signalling pathway [68]. NF-κB activation by EBV...
Ngày tải lên: 09/08/2014, 10:23
... disease activity more likely were attributable to the treatment started on the index date, rather than to natural variations in disease activity; switching to a different RA medication after the ... Results The characteristics of the VARA participants measured at the start of each treatment episode were evaluated. Because the characteristics of VARA patients at the...
Ngày tải lên: 25/10/2012, 10:45
... neutrophils, basophils, T lymphocytes, and macrophages, which release additional inflammatory mediators and cytokines, perpetuating the proinflammatory response. This late-phase response is thought to be ... asthma, food allergy, allergic skin inflammation, ocular allergy, and/or anaphy- laxis. Contact of an allergen with the immune system starts with handling of it by the antig...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "CD4+CD25+ immunoregulatory T cells may not be involved in controlling autoimmune arthritis" ppsx
... the CD4 + CD25 + regulatory T cells may in part be ascribed to signaling through CTLA-4. CTLA-4 may transduce an acti- vating signal to CD4 + CD25 + regulatory T cells [2]. Although we did not detect any significant ... the CD28–B7 interaction has been shown to regulate disease susceptibility by rendering autoreactive T cells anergic, or alternatively by upregulating...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx
... CD4 + CD25 + Treg and detected an accumulation in the inflamed joints, thus excluding the possibility that the lack of therapeutic activity was due to the inability of CD4 + CD25 + Treg to migrate into the ... actual, in a clinical setting, efficacy of Treg to treat active chronic autoimmune diseases such as RA. The second is how we can practically deliver their therapeuti...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " High recombination rates and hotspots in a Plasmodium falciparum genetic cross" docx
... recombination hotspots with conserved motifs that may mediate frequent recombination in the parasite. The high RR may provide the genetic basis for the parasite to rapidly adapt to a hostile environment and ... into male and female sexual stages - termed gametocytes - that circulate in the bloodstream. When the gametocytes are taken up by a feeding mosquito during a...
Ngày tải lên: 09/08/2014, 22:24
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... coevolved with CCT surface areas, allowing the interaction of Antarctic b-tubulin isotypes with CCT in the adverse energetic conditions of the Antarctic habitat. The role of these amino acid substitutions ... identical to the b -T1 sequence, except for the TAG codon that was mutated to TGG for tryptophan, as this amino acid is conserved at position 21 in most tubulins from...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... GAAGTCCAGGCCCAGTTTGA CDS 152–171 152–171 0 AS-4 TCAATTAAGTAGGGCAGATT CDS 175–194 175–194 0 AS-5 TCTCCA AAACGTCCACACGA CDS – 285–304 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGT...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt
... be challenged a second time to confirm that any reaction or exacerbation is truly due to the drug being tested. Finally, in patients with a history of an allergic or anaphylactic reaction to ASA ... results. 16 Interestingly, and similarly to patients with aspirin-exacerbated respiratory disease (AERD), in patients with acute urticaria induced by distinct NSAIDs (both wit...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx
... significantly to writing the article. HEV and RWF also contributed to the selection and inclusion of cases and controls. JvdP also contributed to the statistical analysis of the data. All authors read ... clinical trials that demonstrated the efficacy and safety of selective COX-2 inhibitors were conducted in relatively young, healthy subjects. Our study suggests that these ma...
Ngày tải lên: 09/08/2014, 10:20