Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3'siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3'T7...
- 8
- 576
- 0
Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt
... acquisitionand analysis of the data. BK was involved in the developmentand adaptation of the ELISA method for SF and in the acquisi-tion of data. CAM was involved in data acquisition. EJMAT wasinvolved ... design, analysis,interpretation, and writing of the data. BSF was involved in theacquisition, analysis and interpretation of the data and in draft-ing the manuscript. MM was involved in sample acquisitionand ... Standard of keratan sulfate purifiedfrom human costal cartilage [20]. The intra-assay variation was<3%, and the inter-assay variation was <4%.Measurement of HA by ELISAHyaluronan in...
- 10
- 406
- 0
Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt
... suggest that binge eatingsymptomatology may play an important role in the initi-ation and maintenance of the WG phenomenon observed in at least part of patients with schizophrenia. Finally,management ... nervosa (BN).Psychiatric status was assessed through a chart review,medical doctor referee and psychiatrist interview.Data analysesStatistical analysis was performed by SPSS 12.0 program.An initial ... Interventions for Weight Gain in AdultsTreated With Novel Antipsychotics. Prim Care Companion J ClinPsychiatry 2000, 2:20-23.5. Association AP: Diagnostic and statistical manual of mental disorders....
- 4
- 331
- 0
Báo cáo y học: "High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis" potx
... OA synovial membranes was con-ducted by one of the investigators (PS), who has diag-nosed more than 2500 synovial tissue samples of RA.DNA microarray analysis A global expression analysis of ... unravel disease-specific differences that are character-istic for synovial tissue from patients with RA versus OAdisease, total RNA from 30 mg synovial tissue was iso-lated. Quality of all samples ... immunohistologic analysis of distribution of CXCR1,CXCR2, and CXCR3, synovial tissue from patients with RA and OA was fixed in 4% formaldehyde immediatelyafter surgery and subsequently embedded in paraffin...
- 12
- 402
- 0
Báo cáo y học: "CXCR3/CXCL10 expression in the synovium of children with juvenile idiopathic arthritis" pot
... by macrophages in synovial mem-brane of patients with JIA but not of controls. This findingsuggests that CXCL10 is part of the matrix of cytokinesthat regulates the accessory activity of macrophages ... revised criteria for JIAaccording to the International League of Associations for Rheumatology (ILAR) classification [8] and were managedat the Pediatric Rheumatology Unit of Padua University.The ... Facco3, Anna Cabrelle3, Marialuisa Valente2, Franco Zacchello1 and Carlo Agostini31Department of Paediatrics, Padua University School of Medicine, Italy2Pathology Institute, Padua...
- 9
- 449
- 0
Báo cáo y học: "Godoy & Godoy technique in the treatment of lymphedema for under-privileged populations."
... myolymphokinetic activities have been developed for the treatment of lymphedema. This novel approach can be adapted for the treatment of lymphedema in mass. Key words: lymphedema, filariasis, ... reporting recent advances and contributions. A new technique of manual lymph drainage, mechanisms of compression, development of active and passive exercising apparatuses and the adaptation of ... water displacement should be used as this examination is simple, cheap and feasible in any community. Control of the volumetry of limbs is fundamental and should be performed on a daily basis...
- 4
- 646
- 0
Báo cáo y học: " Vacuum-assisted closure in the treatment of early hip joint infection"
... can only be performed after an exact anatomical preparation and mobilisation of the tissue layers. This anatomical preparation and the resulted reconstruction of the soft-tissue layers may ... Postoperatively, all patients have been treated with systemic antibiosis according to antibiogram for the first 2 weeks followed by an oral antibiosis for another 2 weeks. In cases without germinal ... V .A. C. – system increased the granu-lation tissue formation and the local blood flow, and enhanced the bacterial clearance function [13]. Since interstitial edema is eliminated without any...
- 6
- 575
- 1
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... gentamicin and may therefore be more effec-tive in preventing biofilm formation than Palacos. When mixing the cement with antibiotics, it is important to leave as many large crystals intact as ... frequency of femoral and acetabular defects asso-ciated with THA infections [7-9]. The aim of a two-stage revision is to eradicate any residual bacteria after removal of the prosthesis and ... include tobramycin, gentamicin and vanco-mycin [26]. The combination of vancomycin and one of the aminoglycosides provides a broad spectrum of coverage for organisms commonly encountered with deep...
- 5
- 549
- 0
Báo cáo y học: "Progress and Challenges in the Understanding of Chronic Urticaria" pptx
... distinguish patients with idiopathic urticaria from patients with autoimmune urticaria. A basophil abnormality is of particular interest becausesome patients with chronic urticaria have basopenia31andhyporesponsiveness ... TH1/TH2 cytokines andinflammatory cells in skin biopsy specimens from patients with chronic idiopathic urticaria: comparison with the allergen-inducedlate-phase cutaneous reaction. J Allergy Clin ... disease activity. Clin Exp Allergy 2003;33:337–41.45. Sabroe RA, Poon E, Orchard GE, et al. Cutaneous inflammatorycell infiltrate in chronic idiopathic urticaria: comparison of patients with...
- 5
- 467
- 1
Báo cáo y học: "Active DNA demethylation in human postmitotic cells correlates with activating histone modifications, but not transcription levels" ppt
... only actively demethylate cytosine residues, weFigure 3 Comparison of MCIp microarray and MassARRAY EpiTYPER data. (a- c) Diagrams at the top show signal ratios of microarray probes for both independent ... individual transfections was normal-ized against Renilla luciferase activity.Additional materialAbbreviationsAICDA: activation-induced cytidine deaminase; bp: base pair; ChIP: chromatinimmunoprecipitation; ... history of active DNA demethylation. Cell 2008, 133:1145-1148.17. Kim MS, Kondo T, Takada I, Youn MY, Yamamoto Y, Takahashi S, Matsumoto T, Fujiyama S, Shirode Y, Yamaoka I, Kitagawa H, Takeyama...
- 11
- 313
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP