Báo cáo y học: " Human Th17 cells " potx

Báo cáo y học: " Human Th17 cells." potx

Báo cáo y học: " Human Th17 cells." potx

... played by Th17 cells in the pathogenesis of human autoimmune disorders, although very probable, is not yet proven. More importantly, the respective roles of Th17 and Th1 cells in inflammatory ... at least in mice, early IL-4 production by naïve Th cells can also be induced by IL-25, a cytokine that is produced not only by Th2 cells but also by an unidentified cell type found in...

Ngày tải lên: 09/08/2014, 10:23

8 445 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... 25:402-408. 52. Takahashi Y, Takahashi S, Shiga Y, Yoshimi T, Miura T: Hypoxic induction of prolyl 4-hydroxylase alpha (I) in cultured cells. J Biol Chem 2000, 275:14139-14146. 53. Chun Y- S, Yeo E-J, Choi ... 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT COL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF pro...

Ngày tải lên: 09/08/2014, 10:20

9 356 0
Báo cáo y học: "Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2" potx

Báo cáo y học: "Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2" potx

... donkey anti-goat IgG biotin- conjugated secondary antibody (Santa Cruz Biotechnology) for collagen type I and collagen type II and donkey anti-rabbit IgG biotin-conjugated secondary antibody for ... anti -human collagen type I (C-18 polyclonal), collagen type II (N-19 polyclonal) (both from Santa Cruz Biotechnology), or rabbit anti -human aggre- can (BR1) (all at 1:100 dilution) followed by...

Ngày tải lên: 09/08/2014, 10:23

11 459 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

... down assays and total lysate analysis were adjusted to ensure identical total protein concentrations as determined by BCA assay (Bio-Rad). Yeast two-hybrid assay Full-length human sprouty 4 cDNA ... hspry4 vs. mspry4 [11]. Unraveling the precise molecular mechanism of action of endogenous sproutys clearly requires additional studies. By performing a yeast two-hybrid analysis, using a human...

Ngày tải lên: 31/03/2014, 15:20

11 542 0
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

... (both for naive and memory T cells) , cytotoxic T-lymphocyte formation, IFN-γ production by Th1 cells, and interleukin-4 pro- duction by Th2 cells. [39,40]. The ability to decrease IFN-γ production, ... of mesenchymal progenitors. Stem Cells 2005, 23:220-229. 26. Yen BL, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, Yen ML, Lee MC, Chen YC: Isolation of multipotent cells from hum...

Ngày tải lên: 09/08/2014, 10:23

12 359 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

... evaluation. Functional analysis of hES-DCs by Mixed Leukocyte Reaction (MLR) assay and antigen uptake assay The T cell stimulatory capacity of DCs derived from hES cells CD34+ progenitor cells was assessed by co-incubat- ing ... He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ: Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization. Cir...

Ngày tải lên: 10/08/2014, 05:20

9 261 0
Báo cáo y học: "Human toxoplasmosis and the role of veterinary clinicians"

Báo cáo y học: "Human toxoplasmosis and the role of veterinary clinicians"

... they are the only animals that pass oocysts in their feces. They become infected by eating infected rodents, birds, or other small animals. Once oocysts are shed, they re- quire 1 to 5 days ... infective. Cats pass oocysts for only 2 to 3 weeks following primary infection. Mature cats are less likely to shed Toxoplasma if they have been previously infected. Litter box hygiene is the ma...

Ngày tải lên: 03/11/2012, 11:06

2 499 0
Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc

Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc

... O9W4W6) and i ndicated by the arrowheads. The s ymbol ÔVÕ indicates a po ten tial N - glycosylation site. A putative polyadenylation signal is enclosed by a box. (B) Hydrophobicity plot of DmNST/DmUGT. ... m M phenylmethanesulfonyl¯uoride], and the samples were fractionated b y electrophoresis on a 12% SDS/polyacrylamide gel. The separated polypeptides were electotransferred to a poly(vinyl...

Ngày tải lên: 21/02/2014, 15:20

11 477 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

... Isotype specificity analysis of the Z IgA1 affibody. Resulting overlay sensorgrams from separate injections of 0.2 l M solutions of human polyclonal IgA and IgA 1 ,humanmyelomaIgA 2 and IgM, human ... Germany, cat. no I-1010), human polyclonal IgA 1 (Calbiochem, USA, cat. no. 400105), human myeloma IgA 2 (Calbiochem, cat. no. 400110), human myeloma IgM (Pharmacia Diagnos- tics), human...

Ngày tải lên: 08/03/2014, 23:20

9 579 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... Carboxyl ester lipase: a highly polymorphic locus on human chromosome 9qter. Ge nomics 10, 425±431. 24. Hui, D .Y. (1996) Molecular biology of enzymes involved with cholesterol ester hydrolysis ... previously been discussed in the literature. Deletion of the tail by in vitro mutagenesis of the human enzyme was shown to signi®cantly decrease expression of the protein, presumably by affecti...

Ngày tải lên: 24/03/2014, 03:21

9 521 0
Từ khóa:
w