Báo cáo y học: " Human Th17 cells " potx
Báo cáo y học: " Human Th17 cells." potx
... played by Th17 cells in the pathogenesis of human autoimmune disorders, although very probable, is not yetproven. More importantly, the respective roles of Th17 andTh1 cells in inflammatory ... at least in mice, earlyIL-4 production by naïve Th cells can also be induced by IL-25,a cytokine that is produced not only by Th2 cells but also by anunidentified cell type found in the gut ... inducedevelopment of IL-17 producing cells. Finally, van Beelen andcolleagues [66] demonstrated that human Th17 cells couldbe derived only by memory, and not by naïve, T cells, and thiseffect was due...
- 8
- 445
- 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx
... 25:402-408.52. Takahashi Y, Takahashi S, Shiga Y, Yoshimi T, Miura T: Hypoxicinduction of prolyl 4-hydroxylase alpha (I) in cultured cells. JBiol Chem 2000, 275:14139-14146.53. Chun Y- S, Yeo E-J, Choi ... 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTTCOL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX, Sry-related HMG box-9.Arthritis ... articular chondrocytes by 5% oxygen tension.This may therefore reflect a greater sensitivity of meniscus cells to oxygen tension. Naturally, articular chondrocytes existin a completely avascular...
- 9
- 356
- 0
Báo cáo y học: "Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2" potx
... donkey anti-goat IgG biotin-conjugated secondary antibody (Santa Cruz Biotechnology)for collagen type I and collagen type II and donkey anti-rabbitIgG biotin-conjugated secondary antibody for ... anti -human collagen typeI (C-18 polyclonal), collagen type II (N-19 polyclonal) (bothfrom Santa Cruz Biotechnology), or rabbit anti -human aggre-can (BR1) (all at 1:100 dilution) followed by washing ... Sakaguchi Y, Nimura A, Yokoyama A, KogaH, Sekiya I: Higher chondrogenic potential of fibrous syn-ovium- and adipose synovium-derived cells compared withsubcutaneous fat-derived cells. Arthritis...
- 11
- 459
- 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... down assays and total lysateanalysis were adjusted to ensure identical total proteinconcentrations as determined by BCA assay (Bio-Rad).Yeast two-hybrid assayFull-length human sprouty 4 cDNA ... hspry4 vs. mspry4 [11]. Unravelingthe precise molecular mechanism of action of endogenoussproutys clearly requires additional studies.By performing a yeast two-hybrid analysis, using a human ... receptors. By differential display RT-PCR of activatedvs. resting umbilical artery smooth muscle cells (SMCs) wedetected a new human sprouty gene, which we designated human sprouty 4 (hspry4) based...
- 11
- 542
- 0
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... (bothfor naive and memory T cells) , cytotoxic T-lymphocyteformation, IFN-γ production by Th1 cells, and interleukin-4 pro-duction by Th2 cells. [39,40]. The ability to decrease IFN-γproduction, ... ofmesenchymal progenitors. Stem Cells 2005, 23:220-229.26. Yen BL, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, YenML, Lee MC, Chen YC: Isolation of multipotent cells from human term ... generallyobserved: (a) fibroblast-like spindle-shaped morphology, (b)round morphology and large nuclei (monocytic contamina-tion), and (c) very small, epitheloid cells with polygonal mor-phology...
- 12
- 359
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... evaluation.Functional analysis of hES-DCs by Mixed Leukocyte Reaction (MLR) assay and antigen uptake assayThe T cell stimulatory capacity of DCs derived from hES cells CD34+ progenitor cells was assessed by co-incubat-ing ... He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ: Human embryonicstem cells develop into multiple types of cardiac myocytes:action potential characterization. Circ Res 2003, 93:32-39.7. Assady S, Maor ... progenitor cells [11]. As these cells possess the ability to self-renew, they have the poten-tial to continually produce HIV resistant T cells, macro-phages, and dendritic cells in the body thus...
- 9
- 261
- 0
Báo cáo y học: "Human toxoplasmosis and the role of veterinary clinicians"
... they are the only animals that pass oocysts in their feces. They become infected by eating infected rodents, birds, or other small animals. Once oocysts are shed, they re-quire 1 to 5 days ... infective. Cats pass oocysts for only 2 to 3 weeks following primary infection. Mature cats are less likely to shed Toxoplasma if they have been previously infected. Litter box hygiene is the main ... it is not necessary, for example, to give away one’s cat during pregnancy and that if they follow a few very simple “rules”, liv-ing with their pets need not represent any risk for infection...
- 2
- 499
- 0
Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc
... O9W4W6) and i ndicated by the arrowheads. The s ymbol ÔVÕ indicates a po ten tial N -glycosylation site. A putative polyadenylation signal is enclosed by a box. (B) Hydrophobicity plot of DmNST/DmUGT. ... mMphenylmethanesulfonyl¯uoride], and thesamples were fractionated b y electrophoresis on a 12%SDS/polyacrylamide gel. The separated polypeptides wereelectotransferred to a poly(vinylydene ... carbohydrate chains by appropriate glyco-syltransf erase s. Changes in the activities of NSTs mayaffect the structure of oligosaccharide chains by affectingthe availability of substrates for glycosyltransferases...
- 11
- 477
- 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt
... Isotype specificity analysis of the ZIgA1affibody. Resultingoverlay sensorgrams from separate injections of 0.2 lMsolutions of human polyclonal IgA and IgA1,humanmyelomaIgA2and IgM, human ... Germany, cat. noI-1010), human polyclonal IgA1(Calbiochem, USA, cat.no. 400105), human myeloma IgA2(Calbiochem, cat.no. 400110), human myeloma IgM (Pharmacia Diagnos-tics), human polyclonal ... selectivity of the ligand was high.Affinity recovery of IgA from human plasmaThe potential use of the ZIgA1affibody as affinity ligand forselective chromatographic recovery of IgA directly fromhuman...
- 9
- 579
- 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... Carboxyl ester lipase: ahighly polymorphic locus on human chromosome 9qter. Ge nomics10, 425±431.24. Hui, D .Y. (1996) Molecular biology of enzymes involved withcholesterol ester hydrolysis ... previously been discussed in the literature. Deletionof the tail by in vitro mutagenesis of the human enzyme wasshown to signi®cantly decrease expression of the protein,presumably by affecting ... completelydispensable for the typical functional properties of BSSL,i.e. catalytic activity, bile-salt activation, heparin binding,heat stability, stability at low pH and resistance toproteolytic...
- 9
- 520
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ