Báo cáo khoa học: " A phase III trial comparing an anionic phospholipid-based cream and aloe vera-based gel in the prevention of radiation dermatitis in pediatric patients" pdf

... to the three models (BGM, BEM, WFM) specified in equations (2-4) and explained in the main text. 3 A probabilistic Model for TDS This section describes the probabilistic generative model which ... Head-Driven Statistical Models for Natural Language Parsing. Ph.D. the- sis, University of Pennsylvania. Marie-Catherine de Marneffe and Christopher D. Man- ning. 2008. The Stanford Typ...

Ngày tải lên: 20/02/2014, 04:20

... Saarbr ă ucken {neumann|schmeier}@dfki.de Abstract We present a mobile touchable application for online topic graph extraction and exploration of web content. The system has been imple- mented for operation on an iPad. The topic graph is constructed ... CP D M . It is used for constructing the topic graph in the final step. For- mally, a topic graph T...

Ngày tải lên: 20/02/2014, 05:20

... Press, New York. 44 Karasawa S, Araki T, Yamamoto-Hino M & Miyawaki A (2003) A green-emitting fluorescent protein from Galaxeidae coral and its monomeric version for use in fluorescent labeling. ... evolution of a monomeric, bright and photostable version of Clavularia cyan fluorescent pro- tein: structural characterization and applications in fluo- rescence...

Ngày tải lên: 06/03/2014, 11:20

... seg- mentation only and joint segmentation and part-of-speech tagging. On the Penn Chinese Treebank 5.0, we obtain an error reduction of 18.5% on segmentation and 12% on joint seg- mentation and part-of-speech ... a cascaded linear model for joint Chinese word segmentation and part- of-speech tagging. With a character-based perceptron as the core, combi...

Ngày tải lên: 08/03/2014, 01:20

... Access A phase II randomized trial comparing radiotherapy with concurrent weekly cisplatin or weekly paclitaxel in patients with advanced cervical cancer Fady B Geara 1* , Ali Shamseddine 2 , ... as: Geara et al.: A phase II randomized trial comparing radiotherapy with concurrent weekly cisplatin or weekly paclitaxel in patients...

Ngày tải lên: 09/08/2014, 09:20

... and late toxicity. As in our study, the acute toxicity consisted of dose- limiting GI toxicity. Application of the linear quad- ratic model indicates that 42 Gy in 2.8 Gy-fractions is bio- logically ... considerations The study intent was to determinate the DLT of escalating doses of RT delivered concurrently with a fixed dose of gemcitabine (300 mg/m 2 ) adm...

Ngày tải lên: 09/08/2014, 09:22

... JS, PB and DP conducted patient exams and participated in data collection. TD par- ticipated in the collection of data and data analyses. CL and XX assisted in writing the manuscript. All authors read ... after radiation therapy was initiated, the skin was usually treated daily with an aloe vera-based gel. The patients or their caregivers would apply the ge...

Ngày tải lên: 09/08/2014, 10:21

... randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193) Mary Margaret Huizinga 2,3,12 , Ayumi Shintani 4 , Stephanie Michon 2 , Anne Brown 1,5 , ... Nashville, TN, USA and 12 VA National Quality Scholars Program, Nashville, TN, USA Email: Mary Margaret Huizinga - mary.margaret.huizinga@vanderbilt.edu; Ayu...

Ngày tải lên: 11/08/2014, 05:22

... when a trained facilitator meets with staff and clinicians in each practice over several months to assist the team in addressing an issue, such as improving risk factors for diabetes complications. ... are to: 1. Evaluate the effectiveness and sustainability of PF to improve risk factors for type 2 diabetes complications across a variety of primary ca...

Ngày tải lên: 11/08/2014, 05:22

... purposes) Implementation Science Open Access Study protocol A cluster randomized trial to improve adherence to evidence-based guidelines on diabetes and reduce clinical inertia in primary care physicians in Belgium: ... to address non -adherence to evidence-based guidelines and to reduce &apos ;clinical inertia& apos; in prim...

Ngày tải lên: 11/08/2014, 16:21

... Facility [20]. A line was identified that contained a T-DNA insertion within the first exon of ERS1 (Fig. 1A) . Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtc- cggg), ... 5' to the site of the T-DNA insertion, and ETR1- 3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1- 3'R (5' CAAGCATCCATAACTCGATCCAAATT...

Ngày tải lên: 12/08/2014, 05:20

... care length of stay was 12 ± 8 days and the hospital length of stay was 28 ± 14 days. The tracheostomy rate was 63% and the hospital mortality was 43%. Table 1 Baseline and microbiological characteristics ... pulmonary function with inhaled heparin and other glycosaminoglycans [19 ,20,29]. Heparin has a range of anticoagulant actions and also promotes fibri- nolysis through in...

Ngày tải lên: 13/08/2014, 11:22