Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA ... ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRP...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... the anti- biotic use, financial cost and resistance patterns of leading nosocomial pathogens. Materials and Methods Hospital setting and antibiotic policy: NARP was initiated in Turkey in ... February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11]. This is a quasi-experimental study perfo...
Ngày tải lên: 25/10/2012, 11:00
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... complementa- tion assays. The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods), ... Further identification and quantification of puromycin were achieved by a Pac enzymatic assay [21]. Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadeno...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... 2002 Small heat shock /a- crystallin protein from Artemia (Eur. J. Biochem. 269) 937 Functional analysis of a small heat shock /a- crystallin protein from Artemia franciscana Oligomerization and thermotolerance Julie ... thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously dev...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... substituted cinnamates including sinapate. This catalytic property is shared by only the minority of 4CL isoforms studied to date from any plant. As the cDNA encoding 4CL1 was apparently missing from ... recombinant 4CL2 was able to convert cinnamate, 4-coumarate, caffeate, and f erulate but not sinapate an d 3 ,4-dimethoxycinnamate. As summarized in Table 5, t he K m and r elative V...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... Bioscience (Maarsen, the Netherlands). Bacterial strains The E. coli K-12strainsusedinthisstudyarelistedin Table 1. Strains CE1514 and CE1515 were obtained by P1 transduction using strain CE1224 as the ... recipient and strains IQ85 and strain MM152, respectively, as donor strains. To obtain strain CE1513, strain MM88 was used as Fig. 1. Physical characteristics of the PhoE signal s...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... anti- bodies directed against leader peptidase and analysis by SDS/PAGE and autoradiography. Proteinase K-accessibility experiments Cells of prlA4 mutant strain NT1004, carrying plasmid pNN8, were grown ... residue in the hydrophobic core of the signal sequence. Tetracycline-resistant prlA + and prlA4 Table 1. Bacterial strains and plasmids used in this study. Cam r and Amp...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... reactivity of a- hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite Hiroshi Sakamoto 1 , Yoshiaki Omata 1 , Shunsuke Hayashi 1 , Saori Harada 1 , Graham Palmer 2 and ... can contain a substantial amount of free a- hydroxyhaem and this can lead to an incorrect interpret- ation of the nature of the enzyme-assisted conversion of a- hydrox...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot
... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGG GG-3¢,forward),GSP 5a( 5¢-GTGGCTTCTTGAGTCAT AGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GT GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse) using Marathon TM cDNA Amplification Kit and Advant- ageÒ cDNA polymerase from ... neuroleptic reserpine, the antihypertensive ajmalicine and the anti- arrhythmic ajmaline. The complex chemical structure of ajmaline, an alkalo...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... reagents were of analytical grade and obtained from local manufacturers. The specific activity of Gra3P DH of EAC cell [10] and rabbit muscle were approximately 1000 and 100 U, respectively, and ... inactivation (K obs )obtainedatvarious concentrations of PP against log of concentration of the reagent. Table 1. Inactivation of Gra3P DH of EAC cells and rabbit muscle...
Ngày tải lên: 24/03/2014, 04:21