Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

... purposes) Radiation Oncology Open Access Research PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair ... intensity-modulated radiotherapy (IMRT) for curative treatment of advanced pharyngeal carcinoma. Patients and methods: Forty five patients...

Ngày tải lên: 09/08/2014, 10:21

... midazolam induced a limitation of the vascular response to ischaemia. Reactive hyperaemia and the combination of midazolam and sufentanil During reactive hyperaemia, addition of sufentanil to mida- zolam did ... All data are expressed as means ± standard error of the mean except for the frequencies of vasomotion expressed as a median. Repeated measures analysis of variance wa...

Ngày tải lên: 13/08/2014, 03:20

... 0.05. Results Radiation-induced apoptosis Data of RIA were available in all 26 breast cancer patients, as shown in Table 1. RIA values increased with radiation dose (Table 1), and data fitted to a semi-loga- rithmic ... R, Luna JD, Ruiz de Almodovar JM: Radiation-induced DNA damage as a predictor of long-term toxicity in locally advanced breast cancer patients treated with high-do...

Ngày tải lên: 09/08/2014, 09:20

... Douglas JG, Laramore GE, Austin-Seymour M, Koh W, Stelzer K, Griffin TW: Treatment of locally advanced adenoid cystic car- cinoma of the head and neck with neutron radiotherapy. Int J Radiat Oncol ... Nikoghosyan A, Jakel O, Haberer T, Kraft G, Scholz M, Wannenmacher M, Debus J: Feasibility and toxicity of com- bined photon and carbon ion radiotherapy for locally advanced...

Ngày tải lên: 09/08/2014, 10:21

... both American Cauca- sians and non-Caucasians. Many of the associations, however, are related to race. Protective associations of Cw*01, DRB1*01, DRB1*11 and DQB1*05 and risk associations of A* 01, ... HLA -A and -C alleles are shown in Table 2. A trend of risk association of HLA -A* 01 (OR = 2.41) was observed among the Caucasian population, but this was not statistically signi...

Ngày tải lên: 12/08/2014, 04:21

... glutamic acid systems [9,12] but that would enhance the overall accuracy, would require rapid, specific deacylation of Cav-tRNA Arg by the jack bean enzyme. Cav-tRNA Arg prepared by canavanylation ... Preparation and colorimetric analysis of l-canavanine. Anal Biochem 77, 147–151. 60 Ozinskas AJ & Rosenthal GA (1986) l-Canavanine syn- thesis by zinc-mediated guanidination of l-...

Ngày tải lên: 18/02/2014, 13:20

... pair 5¢-GAC CTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear- ing the restriction e nzyme recognition sites Bam HI and XhoI, respectively. pAO1 DNA, isolated as described previously ... bacterial soil community plays a pivotal role in the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkal...

Ngày tải lên: 19/02/2014, 16:20

... boundaries as hidden variables and include probabilities for let- ter transitions within segments. The ad- vantage of this model family is that it can learn from small datasets and easily gen- eralises ... terms of training set size. We want to remind the reader that our two algorithms are aimed at small datasets. We randomly split each dataset into 10 subsets where each subset was a te...

Ngày tải lên: 20/02/2014, 04:20

... via PMTG word alignment monolingual treebank(s) multitext training multitreebank relative frequency computation relative frequency computation translation input multitext multitree output multitext linearization A2 A1 T3 T5 T1 T2 T4 training application Figure 7: Data-flow diagram for a rudimentary MTSMT system based on generalizations of parsing. take advantage of past and future res...

Ngày tải lên: 20/02/2014, 16:20

... THE DATABASE ATR has constructed a large-scale database which is collected from simulated telephone and keyboard conversations [Ehara]. The sentences collected in Japanese are manually translated ... translated into English. We obtain a bilingual database. The database is called the ATR Dialogue Database(ADD). ATR aims to build ADD to one million words covering two tasks. One tas...

Ngày tải lên: 20/02/2014, 21:20