Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

... purposes) Radiation Oncology Open Access Research PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair ... intensity-modulated radiotherapy (IMRT) for curative treatment of advanced pharyngeal carcinoma. Patients and methods: Forty five patients...

Ngày tải lên: 09/08/2014, 10:21

10 209 0
Báo cáo khoa học: "Microcirculatory alterations induced by sedation in intensive care patients. Effects of midazolam alone and in association with sufentanil" potx

Báo cáo khoa học: "Microcirculatory alterations induced by sedation in intensive care patients. Effects of midazolam alone and in association with sufentanil" potx

... midazolam induced a limitation of the vascular response to ischaemia. Reactive hyperaemia and the combination of midazolam and sufentanil During reactive hyperaemia, addition of sufentanil to mida- zolam did ... All data are expressed as means ± standard error of the mean except for the frequencies of vasomotion expressed as a median. Repeated measures analysis of variance wa...

Ngày tải lên: 13/08/2014, 03:20

9 296 0
Báo cáo khoa học: "Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients" ppt

Báo cáo khoa học: "Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients" ppt

... 0.05. Results Radiation-induced apoptosis Data of RIA were available in all 26 breast cancer patients, as shown in Table 1. RIA values increased with radiation dose (Table 1), and data fitted to a semi-loga- rithmic ... R, Luna JD, Ruiz de Almodovar JM: Radiation-induced DNA damage as a predictor of long-term toxicity in locally advanced breast cancer patients treated with high-do...

Ngày tải lên: 09/08/2014, 09:20

5 323 0
Báo cáo khoa học: " Inverse planned stereotactic intensity modulated radiotherapy (IMRT) in the treatment of incompletely and completely resected adenoid cystic carcinomas of the head and neck: initial clinical results and toxicity of treatment" potx

Báo cáo khoa học: " Inverse planned stereotactic intensity modulated radiotherapy (IMRT) in the treatment of incompletely and completely resected adenoid cystic carcinomas of the head and neck: initial clinical results and toxicity of treatment" potx

... Douglas JG, Laramore GE, Austin-Seymour M, Koh W, Stelzer K, Griffin TW: Treatment of locally advanced adenoid cystic car- cinoma of the head and neck with neutron radiotherapy. Int J Radiat Oncol ... Nikoghosyan A, Jakel O, Haberer T, Kraft G, Scholz M, Wannenmacher M, Debus J: Feasibility and toxicity of com- bined photon and carbon ion radiotherapy for locally advanced...

Ngày tải lên: 09/08/2014, 10:21

6 472 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

... both American Cauca- sians and non-Caucasians. Many of the associations, however, are related to race. Protective associations of Cw*01, DRB1*01, DRB1*11 and DQB1*05 and risk associations of A* 01, ... HLA -A and -C alleles are shown in Table 2. A trend of risk association of HLA -A* 01 (OR = 2.41) was observed among the Caucasian population, but this was not statistically signi...

Ngày tải lên: 12/08/2014, 04:21

8 499 0
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc

... glutamic acid systems [9,12] but that would enhance the overall accuracy, would require rapid, specific deacylation of Cav-tRNA Arg by the jack bean enzyme. Cav-tRNA Arg prepared by canavanylation ... Preparation and colorimetric analysis of l-canavanine. Anal Biochem 77, 147–151. 60 Ozinskas AJ & Rosenthal GA (1986) l-Canavanine syn- thesis by zinc-mediated guanidination of l-...

Ngày tải lên: 18/02/2014, 13:20

12 560 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... pair 5¢-GAC CTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear- ing the restriction e nzyme recognition sites Bam HI and XhoI, respectively. pAO1 DNA, isolated as described previously ... bacterial soil community plays a pivotal role in the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkal...

Ngày tải lên: 19/02/2014, 16:20

8 648 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... boundaries as hidden variables and include probabilities for let- ter transitions within segments. The ad- vantage of this model family is that it can learn from small datasets and easily gen- eralises ... terms of training set size. We want to remind the reader that our two algorithms are aimed at small datasets. We randomly split each dataset into 10 subsets where each subset was a te...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
Tài liệu Báo cáo khoa học: "Statistical Machine Translation by Parsing" pptx

Tài liệu Báo cáo khoa học: "Statistical Machine Translation by Parsing" pptx

... via PMTG word alignment monolingual treebank(s) multitext training multitreebank relative frequency computation relative frequency computation translation input multitext multitree output multitext linearization A2 A1 T3 T5 T1 T2 T4 training application Figure 7: Data-flow diagram for a rudimentary MTSMT system based on generalizations of parsing. take advantage of past and future res...

Ngày tải lên: 20/02/2014, 16:20

8 433 0
Tài liệu Báo cáo khoa học: "AUTOMATIC NOUN CLASSIFICATION BY USING " ppt

Tài liệu Báo cáo khoa học: "AUTOMATIC NOUN CLASSIFICATION BY USING " ppt

... THE DATABASE ATR has constructed a large-scale database which is collected from simulated telephone and keyboard conversations [Ehara]. The sentences collected in Japanese are manually translated ... translated into English. We obtain a bilingual database. The database is called the ATR Dialogue Database(ADD). ATR aims to build ADD to one million words covering two tasks. One tas...

Ngày tải lên: 20/02/2014, 21:20

8 370 0
Từ khóa:
w