... recurrence as a significantly worse prognostic factor compared with adjuvant radiotherapy. The addition of radiotherapy to the treatment concept was a positive prognostic factor in the multivariate analysis. Conclusion: ... major anatomic locations in which they arise, they are classified as: extra- abdominal fibromatosis, abdominal desmoid, occurring typically in wome...
Ngày tải lên: 09/08/2014, 10:21
... Data acquisition analy- sis and interpretation. Watsonia 12, 81-101 Rushton BS (1983) An analysis of variation of leaf characters in Quercus robur L and Q pe- traea (Matt) ... of the 3 groups, and the F-values of the vari- ance-analytical comparison of groups 1 and 2 (Welch-Test, BMDP 7D) are includ- ed. None of the analyzed features...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: " Radiation-induced skin injury in the animal model of scleroderma: implications for post-radiotherapy fibrosis" ppt
... the American College of Radiology, Ameri- can College of Surgeons, College of American Pathologists, and Soci- ety of Surgical Oncology: Standards for diagnosis and management of invasive breast ... Each point for leg extension data represents mean value for the group. The error bars represent the stand- ard deviation of the mean. Free (panel A) and total (panel B) tran...
Ngày tải lên: 09/08/2014, 09:22
Báo cáo khoa học: " Preoperative external beam radiotherapy and reduced dose brachytherapy for carcinoma of the cervix: survival and pathological response" potx
... dis- tant control. In fact, the standard approach for advanced cervical cancer has been changed after 3 randomized trials and a meta-analysis demonstrate significant benefit of concomitant chemoradiotherapy ... following preoperative radiotherapy with external beam irradiation and high dose rate brachy- therapy. Chemotherapy was not administered to any of them. Median age was 46...
Ngày tải lên: 09/08/2014, 10:21
Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitrificans pptx
... DNA using forward (5¢-GGAGGGATCCCATATG AAGTCTAAATTTAAATTAACG-3¢) and reverse (5¢-GC GTG CTCGAGCGATCCATGGAGCCGTA-3¢) primers that incorporated BamHI and NdeI restriction sites in the 5¢-end of the ... denitrificans is summarized in Fig. 9. pRKAADH consisted of a 3.5 kb region of the A. faecalis aau gene cluster (containing aauB, aauE, aauD, aauA and orf-2) fused to the P. d...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GCCATGCTAGCAATCATCACCGTAG CHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423 MIH-LF GAGTTATCAACGACGAGTGTCC MIH-LR GAGACGACAAGGCTCAGTCC 249 AK-LF AAAGGTTTCCTCCACCCTGT AK-LR ACTTCCTCGAGCTTGTCACG 450 CHH-SF GACTTGGAGCACGTGTGT CHH-SR ... than at any other time in the moult cycle. As quantities of CHH were quite variable at different stages, ratios of CHH/MIH were calculated for pairs of sinus glands....
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Adipocyte hyperplasia and RMI1 in the treatment of obesity doc
... Sakai T, Sakaue H, Nakamura T, Okada M, Matsuki Y, Watanabe E, Hiramatsu R, Nakayama K, Nakay- ama KI & Kasuga M (2007) Skp2 controls adipocyte proliferation during the development of obesity. ... mass. In addition, the mutants were also resistant to obesity induced by the A y gene. Of particular note is the fact that the deficient mice showed a rate of weight gain an...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx
... 0.001(***). Acknowledgements Financial support for this work was provided in part by the Natural Science and Engineering Research Council of Canada (NSERC) and Canadian Institutes of Health Research ... were then removed and placed into scintillation vials containing scin- tillation liquid (ScintiSafe Plus 50%, Fisher Scientific Canada, Ottawa, Canada). Radioactivity was counted 24 h l...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
... mutual structural, electrostatic and dynamical differences. CD and Raman are sensitive to small structural changes [28,29]. In addition, Raman scattering is a powerful means of clearing up the various ... (1668) and 1695–1730 cm )1 (dT) bands results from partial base unstacking affecting mainly adenine and thymine, and to a lesser degree also guan- ine [30,41,42,44–49]. Globally, R...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: "PARSING VS. TEXT PROCESSING IN THE ANALYSIS OF DICTIONARY DEFINITIONS" pot
... of all this effort is a rudimentary parsing system, in which the tagged vocabulary is the lexicon, the tagging program is the lexical analyzer, and the head finder is a syntax analyzer using ... have often been combined with the analysis of machine-readable dictionaries. Since 1979, a group at HT under the leadership of Manha Evens has been using the mac...
Ngày tải lên: 08/03/2014, 18:20