Báo cáo khoa học: " The impact of radiotherapy in the treatment of desmoid tumours An international survey of 110 patients A study of the Rare Cancer Network" pptx

Báo cáo khoa học: " The impact of radiotherapy in the treatment of desmoid tumours. An international survey of 110 patients. A study of the Rare Cancer Network" pptx

... recurrence as a significantly worse prognostic factorcompared with adjuvant radiotherapy. The addition of radiotherapy to the treatment concept was a positive prognostic factor in the multivariate analysis.Conclusion: ... major anatomiclocations in which they arise, they are classified as: extra-abdominal fibromatosis, abdominal desmoid, occurringtypically in women during or following pregnancy; andintra-abdominal ... Prescribing, recording and reporting photonbeam therapy. In International Commission on radiation units andmeasurements Bethesda, Maryland; 1993. 14. Easter DW, Halasz NA: Recent trends in the management...

Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

... Data acquisition analy-sis and interpretation. Watsonia 12, 81-101Rushton BS (1983) An analysis of variation of leaf characters in Quercus robur L and Q pe-traea (Matt) ... of the 3 groups, and the F-values of the vari-ance-analytical comparison of groups 1and 2 (Welch-Test, BMDP 7D) are includ-ed. None of the analyzed features allowsthese ... regions was of minor im-portance.MATERIALS AND METHODS(for details see Aas, 1988)Oaks were chosen from 30 different stands in Germany and Poland (stands of pedunculateoak,...

Báo cáo khoa học: " Radiation-induced skin injury in the animal model of scleroderma: implications for post-radiotherapy fibrosis" ppt

... the American College of Radiology, Ameri-can College of Surgeons, College of American Pathologists, and Soci-ety of Surgical Oncology: Standards for diagnosis andmanagement of invasive breast ... Each point for leg extension data represents mean value for the group. The error bars represent the stand-ard deviation of the mean.Free (panel A) and total (panel B) transforming growth factor ... Breast-conserving therapy in the setting of collagen vascular disease. Cancer J 2001, 7:480-491.6. Morris MM, Powell SN: Irradiation in the setting of collagen vas-cular disease: Acute and late complications....

Báo cáo khoa học: " Preoperative external beam radiotherapy and reduced dose brachytherapy for carcinoma of the cervix: survival and pathological response" potx

... dis-tant control. In fact, the standard approach for advancedcervical cancer has been changed after 3 randomized trialsand a meta-analysis demonstrate significant benefit of concomitant chemoradiotherapy ... following preoperative radiotherapy with external beam irradiation and high dose rate brachy-therapy. Chemotherapy was not administered to any of them. Median age was 46 years (range 22–72). Squamouscell ... 0.03). Also there was an advantage in (a) Overall survival (OS) in 67 cervix cancer patients submitted to preoperative radiotherapyFigure 1 (a) Overall survival (OS) in 67 cervix cancer patients...

Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitriﬁcans pptx

... DNA using forward (5¢-GGAGGGATCCCATATGAAGTCTAAATTTAAATTAACG-3¢) and reverse (5¢-GCGTGCTCGAGCGATCCATGGAGCCGTA-3¢) primersthat incorporated BamHI and NdeI restriction sites in the 5¢-end of the ... denitriﬁcansis summarized in Fig. 9. pRKAADH consisted of a 3.5 kbregion of the A. faecalis aau gene cluster (containing aauB,aauE, aauD, aauA and orf-2) fused to the P. denitriﬁcansmethylamine ... detected. MADH expression was similar in wild-type P. denitriﬁcans and pRKAADH containingP. denitriﬁcans.Characterization of recombinant AADHDuring the puriﬁcation of recombinant AADH, the elution...

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... GCCATGCTAGCAATCATCACCGTAGCHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423MIH-LF GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR ... than at any othertime in the moult cycle. As quantities of CHH were quitevariable at different stages, ratios of CHH/MIH werecalculated for pairs of sinus glands. This analysis showedthat the ... Yoshimura, S., Kawakami,T., Aimoto, S. & Sonobe, H. (2000) Changes in the amounts of the molt-inhibiting hormone in sinus glands during the molt cycle of the American crayﬁsh, Procambarus clarkii....

Báo cáo khoa học: Adipocyte hyperplasia and RMI1 in the treatment of obesity doc

... Sakai T, Sakaue H, Nakamura T, Okada M, MatsukiY, Watanabe E, Hiramatsu R, Nakayama K, Nakay-ama KI & Kasuga M (2007) Skp2 controls adipocyteproliferation during the development of obesity. ... mass. In addition, the mutants were also resistant to obesityinduced by the A ygene. Of particular note is the factthat the deﬁcient mice showed a rate of weight gainand amount of food intake ... storage of the excess energy in the form of intracellular triacylglycerol droplets in adipose cells,leading to an increased fat mass and ultimately result-ing in obesity.Adipocyte hyperplasia (increase...

Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

... 0.001(***).AcknowledgementsFinancial support for this work was provided in partby the Natural Science and Engineering ResearchCouncil of Canada (NSERC) and Canadian Institutes of Health Research ... were thenremoved and placed into scintillation vials containing scin-tillation liquid (ScintiSafe Plus 50%, Fisher ScientiﬁcCanada, Ottawa, Canada). Radioactivity was counted 24 hlater, using ... Sigma (Oakville, Canada); formalinfrom Fisher Scientiﬁc (Nepean, Canada); Alamar bluereagent from Biosource (Montreal, Canada); paraformal-dehyde (PFA) from BDH Laboratories (Poole, UK);glia-speciﬁc...

Báo cáo khoa học: C ﬁ G base mutations in the CArG box of c-fos serum response element alter its bending ﬂexibility Consequences for core-SRF recognition potx

... mutualstructural, electrostatic and dynamical differences. CDand Raman are sensitive to small structural changes[28,29]. In addition, Raman scattering is a powerfulmeans of clearing up the various ... (1668) and 1695–1730 cm)1(dT) bandsresults from partial base unstacking affecting mainlyadenine and thymine, and to a lesser degree also guan-ine [30,41,42,44–49]. Globally, Raman bands related ... tem-peratures. The increase in intensity of the 926 (924),1444 and 1462 cm)1vibrational bands of deoxyriboseand of the 790 and 1056 cm)1bands of backbonereﬂects the disappearance of this linear...

Báo cáo khoa học: "PARSING VS. TEXT PROCESSING IN THE ANALYSIS OF DICTIONARY DEFINITIONS" pot

... of all this effort is a rudimentary parsing system, in which the tagged vocabulary is the lexicon, the tagging program is the lexical analyzer, and the head finder is a syntax analyzer using ... have often been combined with the analysis of machine-readable dictionaries. Since 1979, a group at HT under the leadership of Manha Evens has been using the machine-readable version of Webster' ... began with a list of about fifty relations, intending to generate plain parse trees and then examine them for relational triples in a separate step. It soon became clear, however, that the...

Xem thêm