Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt

... article Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model Koji Hattori 1,2 , Kota ... Kota Uematsu 2 , Yohei Tanikake 2 , Takashi Habata 2 , Yasuhito Tanaka 2 , Hiroshi Yajima 2 and Yoshinori Takakura 2 1 Department of DAIWA HOUSE In...

Ngày tải lên: 09/08/2014, 10:21

9 404 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 Fibromodulin 65 442 F CTGGACCACAACAACCTGAC R GGATCTTCTGCAGCTGGTTG AF020291 Lumican ... animals may permit analysis of affected and unaffected cartilage within one joint area. Although morphological and histological changes in cartilage were most notable in...

Ngày tải lên: 09/08/2014, 06:23

10 416 0
Báo cáo y học: "Global Assessment of Functioning (GAF): properties and frontier of current knowledge" docx

Báo cáo y học: "Global Assessment of Functioning (GAF): properties and frontier of current knowledge" docx

... dis- tinguish between four types of scales: nominal, ordinal, interval and ratio scales. Both nominal and ordinal scales are well known in psychiatry and GAF is an example of an ordinal scale. ... before computer search [38]; in the present study, each issue of a set of journals for the period January 2000 to July 2008 was searched (Acta Psychiatrica Scandinavica, Americ...

Ngày tải lên: 08/08/2014, 23:21

11 441 0
Báo cáo y học: "Current state of cartilage tissue engineering" pot

Báo cáo y học: "Current state of cartilage tissue engineering" pot

... Rocky S Tuan Cartilage Biology and Orthopaedics Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Department of Health and Human Services, National Institutes of Health, ... colla- gen type I-negative, hyaline cartilage- like layer adherent to, and overlying, a dense, mineralized bone-like component, and separated by a well-demarcated inte...

Ngày tải lên: 09/08/2014, 01:23

4 306 0
Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx

Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx

... hydroxychloroquine; LFN, leflunomide; CYA, cyclosporine A; SLZ, sulfasalazine; MCP, metacarpophalangeal; MTP, metatarsophalangeal; PIP, proximal interphalangeal. Available online http://arthritis-research.com/content/9/5/R101 Page ... factors (patient, sample and cutting level) and was analysed by analysis of variance using a general linear model and nested design. All samples at...

Ngày tải lên: 09/08/2014, 10:21

9 430 0
Báo cáo y học: "Phylogenetic assessment of alignments reveals neglected tree signal in gaps" docx

Báo cáo y học: "Phylogenetic assessment of alignments reveals neglected tree signal in gaps" docx

... perfor- mance. Overall, as we have seen that alignments are almost invariably more accurate on amino-acid data, the best nucleotide alignments are obtained by back-translat- ing amino-acid alignments. To ... trees (Additional file 1, Figure S15). Gaps carry substantial unexploited tree signal A notable advantage of our evaluation approach lies in its capacity to assess the accuracy and...

Ngày tải lên: 09/08/2014, 20:21

9 263 0
Báo cáo y học: "Increased levels of circulating microparticles in primary Sjögren''''s syndrome, systemic lupus erythematosus and rheumatoid arthritis and relation with disease activity" pdf

Báo cáo y học: "Increased levels of circulating microparticles in primary Sjögren''''s syndrome, systemic lupus erythematosus and rheumatoid arthritis and relation with disease activity" pdf

... and activity in some inflammatory diseases and catalyzes hydrolysis of aminophos- pholipids, including PS, as well as phosphatidylcholine and phsophatidylethanolamine, all contained in microvesicles ... cells in target organs of autoimmunity and inflammatory infiltrating cells has been Figure 5 Correlation between plasma activity of secretory phospholipase A2 (sPLA 2a)...

Ngày tải lên: 09/08/2014, 14:22

11 381 0
Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot

Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot

... lim- ited amount of available high-quality data relating to drug targets in yeast. We collected two high-quality training sets: an expert-curated set of 83 yeast protein-compound interactions, and yeast ... interactions. Such results can play an invaluable role in understanding and predicting a compound's clinical effects and in guiding its use, including predicting sec...

Ngày tải lên: 09/08/2014, 20:21

17 328 0
Báo cáo y học: "Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire." doc

Báo cáo y học: "Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire." doc

... metazoans/choanoflagellates. In metazoans, but not in choanoflagellates, some cadherins also con- tain an intracellular catenin-binding domain (CBD) that connects intercellular binding via EC ... Jones DA, Hardham AR: Characterization and evolutionary analysis of a large polygalacturonase gene family in the oomycete plant pathogen Phytophthora cinnamomi. Mol Plant Microbe Interact...

Ngày tải lên: 09/08/2014, 20:22

22 355 0
Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

... comparing the same probe in matched normal skin and carcinomas. Including only probes that were expressed above background in both skin and car- cinomas and that did not have a significant eQTL in ... and change in expression level >2 standard deviations from mean between skin and carcinomas are drawn as nodes. Red nodes indicate increased expression in carcinomas...

Ngày tải lên: 09/08/2014, 22:23

11 431 0
Từ khóa:
w