Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt
Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt
... articleSpectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit modelKoji Hattori1,2, Kota ... Kota Uematsu2, Yohei Tanikake2, Takashi Habata2, Yasuhito Tanaka2, Hiroshi Yajima2 and Yoshinori Takakura21Department of DAIWA HOUSE Indoor Environmental Medicine, Nara Medical University, ... vivo assessment. IntroductionAlthough articular cartilage shows durability and the ability tomaintain itself, it has limited capacity for repair [1,2]. The repair cartilage that forms as a result of articular injury has...
- 9
- 404
- 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx
... CAAACTCTTTTGCTTGGGCTR CACTGGACAACTCGCAGATGAF125041Biglycan 65 204 F CCATGCTGAACGATGAGGAAR CATTATTCTGCAGGTCCAGCAF034842Fibromodulin 65 442 F CTGGACCACAACAACCTGACR GGATCTTCTGCAGCTGGTTGAF020291Lumican ... animalsmay permit analysis of affected and unaffected cartilage withinone joint area.Although morphological and histological changes in cartilage were most notable in the lateral compartment, changes ... CCTCCAGGTCAGCTTCGCAANM174030Collagen I 65 460 F CCACCAGTCACCTGCGTACAR GGAGACCACGAGGACCAGAAAF129287Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTGR GTGGGGAAACTGCACAACATL47641GAPDH 55 320 F TCACCATCTTCCAGGAGCGAR GGCGTGGACAGTGGTCATAAAF035421Shown...
- 10
- 416
- 0
Báo cáo y học: "Global Assessment of Functioning (GAF): properties and frontier of current knowledge" docx
... dis-tinguish between four types of scales: nominal, ordinal,interval and ratio scales. Both nominal and ordinal scalesare well known in psychiatry and GAF is an example of anordinal scale. ... beforecomputer search [38]; in the present study, each issue of a set of journals for the period January 2000 to July 2008was searched (Acta Psychiatrica Scandinavica, AmericanJournal of Psychiatry, Archives ... better instructions for scoring within 10-point intervals improve scoring? Internationally, both single and dual scales for GAF are used, but what is the advantage of having separate symptom and...
- 11
- 441
- 0
Báo cáo y học: "Current state of cartilage tissue engineering" pot
... Rocky S Tuan Cartilage Biology and Orthopaedics Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Department of Health and Human Services, National Institutes of Health, ... colla-gen type I-negative, hyaline cartilage- like layer adherent to, and overlying, a dense, mineralized bone-like component, and separated by a well-demarcated interface similar tothat of native ... et al. have shown that the rates of chondro-cyte proliferation and deposition of cartilage- specific gly-cosaminoglycans are significantly higher on polyglycolicacid (PGA)-based scaffolds as...
- 4
- 306
- 0
Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx
... hydroxychloroquine; LFN, leflunomide; CYA, cyclosporine A; SLZ, sulfasalazine; MCP, metacarpophalangeal; MTP, metatarsophalangeal; PIP, proximal interphalangeal.Available online http://arthritis-research.com/content/9/5/R101Page ... factors (patient, sample and cutting level) and wasanalysed by analysis of variance using a general linear model and nested design. All samples at three different cutting levelswere analysed for ... biopsy from a small joint of a RA patient is illustrated in Figure 3. The histological validity and the amount of valuable synovial tissue are detailed in Table1.The success rate of the synovial...
- 9
- 430
- 0
Báo cáo y học: "Phylogenetic assessment of alignments reveals neglected tree signal in gaps" docx
... perfor-mance. Overall, as we have seen that alignments arealmost invariably more accurate on amino-acid data, thebest nucleotide alignments are obtained by back-translat-ing amino-acid alignments.To ... trees (Additional file 1,Figure S15).Gaps carry substantial unexploited tree signal A notable advantage of our evaluation approach lies in itscapacity to assess the accuracy and phylogenetic informa-tion ... sequences in a sample areorthologous to each other [22]. In each trial, a startingsequence from a random species in the innermost leafwas randomly chosen. Then, for each remaining leaf, a random...
- 9
- 263
- 0
Báo cáo y học: "Increased levels of circulating microparticles in primary Sjögren''''s syndrome, systemic lupus erythematosus and rheumatoid arthritis and relation with disease activity" pdf
... and activity in someinflammatory diseases and catalyzes hydrolysis of aminophos-pholipids, including PS, as well as phosphatidylcholine and phsophatidylethanolamine, all contained in microvesicles ... cells in target organs of autoimmunity and inflammatory infiltrating cells has beenFigure 5Correlation between plasma activity of secretory phospholipase A2 (sPLA 2a) (expressed as nmol/min/mL) and ... during the final stages of pro-grammed cell death and are generally larger in diameter and volume than MPs [1]. The outer layer of the bilayer membrane of MPs contains aminophospholipids, mainly...
- 11
- 381
- 0
Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot
... lim-ited amount of available high-quality data relating to drugtargets in yeast. We collected two high-quality trainingsets: an expert-curated set of 83 yeast protein-compoundinteractions, and yeast ... interactions. Suchresults can play an invaluable role in understanding and predicting a compound's clinical effects and in guiding itsuse, including predicting secondary, unwanted drug tar-gets. ... unable to make predic-tions about any of these known interactions, presumablydue to the lack of sequence similarity to the availabletraining sets.Thus, new sources of data and accompanying...
- 17
- 328
- 0
Báo cáo y học: "Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire." doc
... metazoans/choanoflagellates. In metazoans,but not in choanoflagellates, some cadherins also con-tain an intracellular catenin-binding domain (CBD) thatconnects intercellular binding via EC ... Jones DA, Hardham AR: Characterization and evolutionary analysis of a large polygalacturonase gene family in theoomycete plant pathogen Phytophthora cinnamomi. Mol Plant MicrobeInteract 2002, ... polysaccharides such as xylan [70] (Table3) and chitin [74,104]. As a primary pathogen thatusually initiates infection, P. ultimum probably has first-hand access to easily degradable carbohydrates...
- 22
- 355
- 0
Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx
... comparing the same probe in matchednormal skin and carcinomas. Including only probes thatwere expressed above background in both skin and car-cinomas and that did not have a significant eQTL in ... and change in expression level >2 standard deviations from mean between skin and carcinomas are drawn as nodes. Red nodes indicate increased expression in carcinomas and green nodes indicate ... carcinomas, a table detailing cis- and trans-eQTL counts, a table listing genes altered more than twostandard deviations from the mean in carcinomas compared to matchednormal skin, and a table...
- 11
- 431
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ