Báo cáo khoa học: " Combination of celecoxib with percutaneo

Báo cáo khoa học: " Combination of celecoxib with percutaneous radiotherapy in patients with localised prostate cancer – a phase I study" ppt

... Further phase II and III testing is required for efficacy testing. Abbreviations AP Alkaline phosphatase AST Aspartat-Aminotransferase ALT Alanin-Aminotransferase BNED Biochemical no evidence of disease CT ... NSCLC and showed safe administration of 800 mg celecoxib daily and encouraging preliminary outcome results. An additional phase I/ II trial concerning 27 patients with br...

Ngày tải lên : 09/08/2014, 10:20

10
269
0

Báo cáo khoa học: " Quality of life and salivary output in patients with head-and-neck cancer five years after radiotherapy" pptx

... made the analysis and interpretation of the data, and has been involved in drafting the manuscript. CT participated in the design of the study, contributed to the acquisition of data and revised ... items of questionnaire for patients with cancer of the head- and-neck treated with radiotherapy with or without surgery. A significant outcome presents a significant...

Ngày tải lên : 09/08/2014, 10:21

8
377
0

Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

... isoalloxazine ring system and a likely candidate in a position for the abstraction of hydrogen from the substrate. Single-mutant proteins in which Asp367 has been replaced with alanine or asparagine exhibit ... such a gating mechanism. In summary, our data provide evidence that the two invariant serine residues are required to organize a chain of water molecules in the...

Ngày tải lên : 07/03/2014, 05:20

10
398
0

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

... supports the idea of a rather simple recognition interface that can be interrupted by aromatic intercalation. This situation is very similar to aromatic DNA-intercalating agents. Although DNA is the ... that aromatic interactions are important in many cases of amyloid formation. The realization of the role of aromatic moieties in ﬁbril formation is currently being used to deve...

Ngày tải lên : 23/03/2014, 11:20

8
440
0

Báo cáo y học: "Effect of adalimumab on neutrophil function in patients with rheumatoid arthritis" pps

... Sarzi-Puttini 2 , Fabiola Atzeni 2 , Francesca Minonzio 1 , Paola Bonara 1 , Andrea Doria 3 and Mario Carrabba 2 1 Department of Internal Medicine, Ospedale Maggiore Policlinico, IRCCS, University of ... neutrophils indicates that these cells are among the possible targets of anti-TNF-α activity in RA, and may provide an insight into a new and interesting mechanism of action...

Ngày tải lên : 09/08/2014, 06:22

6
579
0

$Báo cáo khoa học: "Intensity modulated or fractionated stereotactic reirradiation in patients with recurrent nasopharyngeal cancer" doc$

Báo cáo khoa học: "Intensity modulated or fractionated stereotactic reirradiation in patients with recurrent nasopharyngeal cancer" doc

... toxicities attributable to reirradiation Late toxicity (grade III) n alteration of taste a 1 alteration of smell a 1 hearing loss a 2 cranial neuropathy 1 trismus 1 xerostomia a 1 a : late radiation ... participated in data acquisition, literature review and drafted the manuscript. FZ, LSE, CTI and CTH participated in data acquisition and literature review. MB, JD and PEH pa...

Ngày tải lên : 09/08/2014, 09:20

11
384
0

Báo cáo y học: " Effects of cyclophosphamide on pulmonary function in patients with scleroderma and interstitial lung disease: a systematic review and meta-analysis of randomized controlled trials and observational prospective cohort studies" ppt

... clinical trials phase II, clinical trials phase III, and clinical trials phase IV. To locate unpublished trials, we searched the electronic abstract databases of the annual scientific meetings ... in manuscript preparation. CPW and ELM participated in the study design, data acquisition and analysis, and in manuscript preparation. PJE participated in data acquisition and in...

Ngày tải lên : 09/08/2014, 13:22

9
477
0

Báo cáo khoa học: "Combination of suberoylanilide hydroxamic acid with heavy ion therapy shows promising effects in infantile sarcoma cell lines" docx

... NN. Epigenetic therapy using the histone deacetylase inhibitor for increasing therapeutic gain in oral cancer: prevention of radiation-induced oral mucositis and inhibition of chemical-induced ... efficacy of combined HIT with HDACI. Our study shows that SAHA is an intriguing novel adjuvant to HIT in certain sarcomas. Conclusion The combination of HDACI like SAHA wi...

Ngày tải lên : 09/08/2014, 09:21

37
316
0

Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx

... MINIREVIEW Selection of stably folded proteins by phage-display with proteolysis Yawen Bai and Hanqiao Feng Laboratory of Biochemistry, National Cancer Institute, Bethesda, MD, USA To facilitate ... which makes it difﬁcult to ﬁnd which mutation or combination of mutations is important for stability. To gain insights into this issue, Martin et al. [15] used phage-display with pro...

Ngày tải lên : 19/02/2014, 12:20

6
444
0

Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

... the major autolysin of Lactococcus lactis MG1363 is a modular protein consisting of an N-terminal active site domain and a C-terminal peptidoglycan-binding domain. The active site domain is homologous ... CGC GAATTCAGATTATGAAACAATAAG EcoRI REPDEL-2 CGC GAATTCTTATGTCAGTACAAGTTTTTG EcoRI REPDEL-3 CGC GAATTCCTTATGAAGAAGCTCCGTC EcoRI ALA-4 CTTCAACAGACAAGTCC REP 4A AGCAAT ACTAGTTTTATA Spe...

Ngày tải lên : 19/02/2014, 18:20

15
460
0