Báo cáo khoa học: " A dosimetric analysis of respiration-gated radiotherapy in patients with stage III lung cancer" pptx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the linguistic contri- bution of morphemes greatly differ according to their types of origin. To ... different according to their types of origin, i.e. the morphemes borrowed mainly from Western languages (borrowed morphemes) and the native morphemes including Chinese- origined morphemes which ... characterise the dynamic nature of mor- phemes in terminology on the basis of a small sample. 1 Introduction In computational linguistics, the interest in ter- minological applications such...

Tài liệu Báo cáo khoa học: Elementary modes analysis of photosynthate metabolism in the chloroplast stroma ppt

... technique of elementary modes analysis. The technique is applied to amodel of chloroplast metabolism to investigate viablepathways in the light, in the dark, and in the dark with the addition of sedoheptulose-1,7-bisphosphatase ... sedoheptulose-1,7-bisphosphatase.DiscussionOne of the original goals motivating this structural inves-tigation of the Calvin cycle was to determine whether or not the traditional reactions of the Calvin cycle are capable of sustaining ... here.Results Elementary modes in the light The main purpose of our structural analysis of the system in the light (i.e. in the absence of oxidative pentose phosphatepathway reactions) was to investigate...

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... into the causes of the distinct behavior of daunorubicin and WP631, we compared the intracellular accumulation of these com-pounds in Jurkat T cells overtime. We also examined the rate and overall ... analysis of lysates of cells treated witheither drug. Daunorubicin was captured by the cells morerapidly, and in a greater amount, than WP631 at any timeanalyzed between 2 and 72 h (Fig. 4). For WP631 ... in the uptake of this bisintercalator between 24766 S. Villamarı´n et al. (Eur. J. Biochem. 270) Ó FEBS 2003 A comparative analysis of the time-dependent antiproliferative effects of daunorubicin...

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... Complex noun sequences. Semantic patterns in complex noun phrases fall into two types: part names and other noun phrases. Names for pieces of equipment often con- tain complex noun sequences, ... Complex noun sequences. A major feature of noun phrases in this set of messages is the presence of many long sequences of left modifiers of nouns, (3). {3) (a) forward kingpost sliding padeye ... increased frequency of complex noun sequences and also increased usage of nominalizations. We would expect to find similar methods of text compres- sion in other types of scientific material...

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change TGA–TCC in T69 (kid T69G) Analysis of Kid RNase ... ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid D75N)PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change ATC–TTA in D75 (kid D75N)PR73H()) ... D75N)PR73H()) ACCACAGGTGTTGTACATTGCGATCAACC Change CGT–CAT in R73 (kid R73H)PR73H(+) GGTTGATCGCAATGTACAACACCTGTGGT Change ACG–ATG in R73 (kid R73H)PH17P()) TCCTACCGCAGGTCCTGAGCAGCAGGGA Change CAT–CCT...

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... compilation ê 2008 FEBS A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells Yusuke Yamamoto1,2,*, Agnieszka Banas1,*, ... that the transcriptome and signal pathways of AT-MSC-Hepa are similar tothose of human primary hepatocytes and that hepatic differentiation has occurred through MET. Human fetal hepatocytes are ... deoxyribonuclease (DNase I, ampliﬁcation grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis sys-tem (Agilent Technologies,...

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

... Quantitative Analysis of Lexical Differences Between Genders in Telephone ConversationsConstantinos BoulisDepartment of Electrical EngineeringUniversity of WashingtonSeattle, 98195boulis@ee.washington.eduMari ... OstendorfDepartment of Electrical EngineeringUniversity of WashingtonSeattle, 98195mo@ee.washington.eduAbstract In this work, we provide an empiri-cal analysis of differences in word use between genders in ... characterize the differences between genders in written text, suchas literary books. A number of monologues havebeen analyzed in (Singh, 2001) in terms of lexical richness using multivariate analysis...

Báo cáo khoa học: " A dosimetric comparison of four treatment planning methods for high grade glioma" pptx

... OncologyResearch A dosimetric comparison of four treatment planning methods for high grade gliomaLeor Zach, Bronwyn Stall, Holly Ning, John Ondos, Barbara Arora, Shankavaram Uma, Robert W ... a pathological diagnosis of Gliob-lastoma Multiforme (GBM, World Health Organization grade IV) and one had Anaplastic Astrocytoma (AA, WorldHealth Organization grade III).Target volumes' ... with a combination of surgery,radiotherapy and chemotherapy. Three dimensional (3D) conformal radiotherapy treatment planning is still the main stay of treatment for these patients. New treatment...

Báo cáo khoa học: " Clinical-dosimetric analysis of measures of dysphagia including gastrostomy-tube dependence among head and neck cancer patients treated definitively by intensity-modulated radiotherapy with concurrent chemotherapy" pdf

... and dysphagia among patients with head and neck cancer treated by definitive intensity-modulated radiotherapy (IMRT) and concurrent chemotherapy.Methods and materials: Thirty-nine patients with ... of 10(page number not for citation purposes)Radiation OncologyOpen AccessResearch Clinical-dosimetric analysis of measures of dysphagia including gastrostomy-tube dependence among head and ... correlated with DVH parameters for patients with locally advanced head and neck cancer treated with definitive concurrent chemotherapy and IMRT. To minimize the risk of pro-longed GT dependence, ...

Báo cáo khoa học: " A dosimetric analysis of respiration-gated radiotherapy in patients with stage III lung cancer" pptx

... Fukuoka M, Kawahara M, et al.: Phase III study of con-current versus sequential thoracic radiotherapy in combina-tion with mitomycin, vindesine, and cisplatin in unresectable stage III non-small-cell ... motion and also respiration-gated PTVs in expira-tory phases. Of note is the finding that significant gainsare attained simply by using individualized 4D mobilitymargins (i.e. PTVall phases) instead ... theaccuracy of respiration-gated radiotherapy. Another approach explored for reducing toxicity is inten-sity-modulated radiotherapy (IMRT). A planning studycomparing IMRT and 3D conformal radiotherapy...

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... RESEARC H ARTIC L E Open Access Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant reproductionKrzysztof ... Zienkiewicz et al .: Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant reproduction. BMC Plant ... Bioquímica, Biolog a Celular y Molecular de Plantas,Estación Experimental del Zaidín (CSIC), Profesor Albareda 1, 18008, Granada,SpainFull list of author information is available at the end of the...

báo cáo khoa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" ppt

... kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjectsJurgen Broeren*1,2, Katharina S Sunnerhagen†1 and Martin Rydmark†2Address: 1Rehabilitation ... was to evaluate thetest-retest reliability of a clinical procedure measuring trajectories with a haptic handheld stylus in a virtual environment and to establish normative data in healthy subjects ... it has the potentialto take a single measurement that takes less than oneminute and produce kinematic data. Further, the meas-ures are objective and repeatable and provide quantitativedata...

báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps

... article as: Kau: A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics. Head& Face Medicine 2011 7:14.Kau Head & Face Medicine 2011, ... outside the mouth shaped like a computermouse and houses the mechanical, electrical, andenergy components to activate the mechanical force from the post. The patient places and activates the device ... a connective tissue attaching the tooth to the alveolar bone. The tissue withstands the compressive forces during chewing while keeping the tooth in place. RANKL is reportedly essential to the osteoclast...

báo cáo khoa học:"A retrospective analysis of submissions, acceptance rate, open peer review operations, and prepublication bias of the multidisciplinary open access journal Head & Face Medicine" doc

... CentralPage 1 of 7(page number not for citation purposes) Head & Face Medicine Open Access ResearchA retrospective analysis of submissions, acceptance rate, open peer review operations, and prepublication ... self -analysis of HFM's matura-tion. The aim of the present paper was therefore to evalu-ate the characteristics of submissions, the effectiveness of the open peer reviewing process, and ... disseminate multidisciplinary knowl-edge in the area of head and face disorders. HFM still isdevelopmental in character and the journal& apos;s ethical pol-icy based on open access and open peer review...

Báo cáo khoa học: "A quantitative analysis of the acidosis of cardiac arrest: a prospective observational study" pdf

... variable on the acid–base status of patients with out -of- hospital cardiac arrestThe impact of each variable on the acid–base status of patients with out -of- hospital cardiac arrest. Each value is ... 4Research A quantitative analysis of the acidosis of cardiac arrest: a prospective observational studyJun Makino1, Shigehiko Uchino2, Hiroshi Morimatsu3 and Rinaldo Bellomo41Staff specialist ... Saitama Medical Center, Saitama Medical School, Saitama, Japan3Staff specialist in intensive care, Department of Anesthesiology and Resuscitology, Okayama University Medical School, Okayama,...

Xem thêm