Báo cáo y học: "Effect of antioxidants on knee cartilage and bone in healthy, middle-aged subjects: a cross-sectional study" ppt

... body mass index, and tibial cartilage volume. c Change in tibial plateau bone area (mm 2 ) per standard-deviation increase in vitamin C/vitamin E intake before and after adjusting for energy intake, ... intake of other carotenoids and knee cartilage or bone measures in the multivariate analyses (Table 3). Relationship between fruit and vegetable intake and knee...

Ngày tải lên: 09/08/2014, 10:20

... was inflammatory cell infiltration (Grades 1-3) in the proximal part of the vein in all 8 animals and in the distal part of the vein in 7 of the 8 animals. Edema (Grades 1-3) was found in ... infiltration (Grades 1-3) at the proximal region of the vein in 4 animas and at the distal region in 3 of the 8 animals, edema (Grade 3) at the proximal region in 1 an...

Ngày tải lên: 26/10/2012, 09:57

... hours. Quantification of cDNA was determined against a standard curve and normalised by the amount of ldh expression. Percentage of increase/decrease expression was calculated by dividing treated ... of malaria parasites. Exp Parasitol 1989; 69: 351-356. 13. Levitt A, Dimayuga FO, Ruvolo VR. Analysis of malarial transcripts using cDNA-directed polymerase chain reaction. J...

Ngày tải lên: 02/11/2012, 10:14

... substrate. These oligomeric substrates were prepared by hybridizing 1 lm of the 5¢-FAM-labeled 29 base DNA 13 -RNA 4 -DNA 12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA 15 - RNA 1 -DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) ... 5¢-TG TG GAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG-3¢ for RNH 2A- R; 5¢-ATAT GAA TTCTCTCTAAGGAGATATACTTAT GACCGTTTC CAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGG...

Ngày tải lên: 17/03/2014, 17:20

... targets of anti-TNF-α activity in RA and may provide an insight into a new and interesting mechanism of action of anti-TNF-α mAbs in the control of inflammatory arthritis. Keywords: adalimumab, neutrophils, ... Francesca Minonzio 1 , Paola Bonara 1 , Andrea Doria 3 and Mario Carrabba 2 1 Department of Internal Medicine, Ospedale Maggiore Policlinico, IRCCS, University...

Ngày tải lên: 09/08/2014, 06:22

... production. LK was involved in planning the project, data analysis and writing of the article. A- KU contributed to the planning and design of the project and participated in both the data analysis and ... Com- pagnone D, Fischkoff SA, Chartash EK: Adalimumab, a fully human anti tumor necrosis factor-alpha monoclonal antibody, and concomitant standard antirheumatic therap...

Ngày tải lên: 09/08/2014, 08:23

... Hospital, Hamilton, ON, Canada. 3 Department of Medicine, McMaster University, Hamilton, ON, Canada. 4 Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON, Canada. Authors’ contributions QC ... questionnaire survey and coordinated the study. AM made substantial contributions to interpretation of data, and was involved in revising the draft critic...

Ngày tải lên: 10/08/2014, 05:21

... revision and gave final approval. AS has performed literature review, data analysis, drafting and final edition. HS has induction of Anesthesia, revised the draft and gave final approval. MK has ... Network; ALT: Alanine Aminotransferase; AST: Aspartate Aminotransferase; CABG: Coronary Artery Bypass Graft; CPB: Cardiopulmonary bypass; CRP: C-reactive protein; IL: Interleukin; IV: Intr...

Ngày tải lên: 10/08/2014, 09:23

... University, Medical Faculty, Kahramanmaras, Turkey, 4 Department of Anesthesiology and Reanimation, Kahramanmaras Sutcu Imam University, Medical Faculty, Kahramanmaras, Turkey and 5 Gaziantep ... surgeons strive these type problems while treating long bone fracture and some times after surgical opera- tions. Demyelinization and remyelinization, axonal degeneration and regener...

Ngày tải lên: 10/08/2014, 10:20

... solution. The solu- tion was put into a Te on liner (30 mL capacity) up to 80% of the total volume. The Te on lined autoclave was sealed and placed in a furnace and maintained at 200 °C for 24 h (in ... addition of sur- factants (MBH-CTAB and MBH-Triton). The increase in the absorption peak intensity and band gap for MBH-SDS nanowhiskers in comparison with the MBH-CT...

Ngày tải lên: 22/06/2014, 00:20