Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx

Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx

Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx

... of 9 (page number not for citation purposes) Vol 9 No 3 Research article HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient ... Guil- herme and colleagues [6]. Risk genotypes for Sydenham's chorea patients are DRB1*07/DQA1*0201 and DQA1*0301/DQB1*0401-2, but the risk haplotypes are...

Ngày tải lên: 09/08/2014, 10:20

9 327 0
Báo cáo y học: " HLA class II associations with rheumatic heart disease among clinically homogeneous patients in children in Latvia" pptx

Báo cáo y học: " HLA class II associations with rheumatic heart disease among clinically homogeneous patients in children in Latvia" pptx

... Stanevicha et al. Research article HLA class II associations with rheumatic heart disease among clinically homogeneous patients in children in Latvia Valda Stanevicha 1 , Jelena Eglite 2 , Arturs ... Research & Therapy Vol 5 No 6 Stanevicha et al. R344 Table 6 Summary of HLA alleles or genotypes associated with rheumatic heart disease Allele associated with risk...

Ngày tải lên: 09/08/2014, 01:23

7 323 0
Báo cáo y học: "The 5.5-year results of MegaOATS – autologous transfer of the posterior femoral condyle: a case-series study" pptx

Báo cáo y học: "The 5.5-year results of MegaOATS – autologous transfer of the posterior femoral condyle: a case-series study" pptx

... evaluated by the Lysholm score and X-ray scans. A random sample of 16 individuals underwent magnetic resonance imaging analysis. The average age at the date of surgery was 34.3 (15 to 59) years, ... 4.9 Lateral Fc 0 MegaOATS Cancellous bone grafting 24 59 58 3.1 Lateral Fc 0 MegaOATS OATS patella, partial synovectomy 25 59 53 4.9 Lateral Fc 0 MegaOATS OATS trochlea, partial synovectomy 26...

Ngày tải lên: 09/08/2014, 10:23

14 380 0
Báo cáo y học: " The L76V mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage" potx

Báo cáo y học: " The L76V mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage" potx

... hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage? AIDS Research and Therapy 2011 8:7. Wiesmann et al. AIDS Research and Therapy 2011, 8:7 http://www.aidsrestherapy.com/content/8/1/7 Page ... mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a...

Ngày tải lên: 10/08/2014, 05:22

9 434 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

... Star). Forward HLA -DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA -DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA -DR measurement by ELISA Ninety six well ELISA plates (Nunc, Denmark) were ... study [22]. Sample preparation and flow cytometry Arterial blood was collected from septic patients on the day sepsis was diagnosed (day 0) and on days 3, 7, and 14 for PCR st...

Ngày tải lên: 03/11/2012, 09:57

11 619 0
Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

... and rat CII (mK and rK, respectively), hydroxylated rat CII (rHyK), denatured rat CII (dCII) and mouse and rat galactosylated CII (mGal- HyK and rGalHyK, respectively) peptides were used. Rat ... was scored as 1, with a maximum of 10 per paw, and an arthritic ankle or mid-paw was given a score of 5. Statistics Arthritis incidence and severity were analysed by χ 2 analy-...

Ngày tải lên: 09/08/2014, 01:24

7 435 1
Báo cáo y học: "HLA-DRB1 genes and extraarticular rheumatoid arthritis" potx

Báo cáo y học: "HLA-DRB1 genes and extraarticular rheumatoid arthritis" potx

... extraarticular features of rheumatoid arthritis (RA) are still unknown. HLA -DR alleles such as HLA -DR4 and HLA -DR1 are associated with the risk to develop RA. A large scale study from Sweden and ... HLA- DRB1*0404) are associated with extraarticular RA globally, but that neither DRB1*0401 nor DRB1*0404 is associated with any particular clinical feature, except for HLA- D...

Ngày tải lên: 09/08/2014, 07:20

2 218 0
Báo cáo y học: "HLA-C locus alleles may modulate the clinical expression of psoriatic arthritis" potx

Báo cáo y học: "HLA-C locus alleles may modulate the clinical expression of psoriatic arthritis" potx

... antibodies) and radiographs. Peripheral and axial joints were evaluated with standard methods. All syn- ovial fluid samples were cultured and analysed for crystals. Pathogens that habitually cause arthritis ... those with five or more swollen joints were defined as having polyarthritis; and patients with inflammatory back pain and bilateral grade II or unilateral grade III o...

Ngày tải lên: 09/08/2014, 08:23

5 369 0
Báo cáo y học: "HLA-G DNA sequence variants and risk of perinatal HIV-1 transmission" pptx

Báo cáo y học: "HLA-G DNA sequence variants and risk of perinatal HIV-1 transmission" pptx

... 5'- TTCCTCTAGGACCTCATGGCC-3' (forward) and 3hlagex8 5'-AGGAAAGGTG ATTGGGGAAG-3' (reverse)), generated a 590-bp fragment that spanned exons 6, 7, intron 7, exon 8 and a part of the 3'-UTR. ... to approximately 1 or 2% after implementation of universal prenatal HIV counseling and testing, antiretroviral proph- ylaxis, elective cesarean delivery and avoidance...

Ngày tải lên: 10/08/2014, 05:20

8 358 0
Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt

Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt

... in part by a research grant from the Italian Society of Hypertension (SIIA) to LAC, by a grant from Italian Ministry of the University and Scientific and Technological Research (MURST) to GC and ... H, Hasegawa M, Sugai S, Obata T, Ugi S, Morino K, Egawa K, Fujita T, Sakamoto T, Nishio Y, Kojima H, Haneda M, Yasuda H, Kikkawa R, Kashiwagi A: Expression of a dominant negative SHP...

Ngày tải lên: 10/08/2014, 05:21

7 331 0
w