Gene therapy with an improved doxycycline-regulated plasmid encoding a tumour necrosis factor-alpha inhibitor in experimental arthritis pot

... inhibited in an experimental model. Materials and methods DNA and cells Plasmid DNA was propagated in DH5-α Escherichia coli and was purified using a standard Plasmid Mega Kit (Qiagen Ltd., Crawley, ... tumour necrosis factor-alpha inhibitor in experimental arthritis David Gould, Nasim Yousaf, Rewas Fatah, Maria Cristina Subang and Yuti Chernajovsky Bone and Joint...

Ngày tải lên: 09/08/2014, 10:20

... illustrated in panels a and b; those with a clinical score of 2 or less at the time of DNA injection (day 27) are illustrated in panels c and d; and animals with a clinical score greater than 2 at the ... expression and increase the magnitude of regulation, as was recently achieved with an adenoviral vector [28]. According to data obtained in clinical trials, transfection...

Ngày tải lên: 09/08/2014, 01:23

... genotyping and ELISA work. DLM conceived and oversaw the study, carried out statistical analyses and interpretation of data, and finalized the manu- script. The final manuscript was read and approved ... Both are transmembrane glycopro- teins with a three domain structure: a multiple cysteine-rich motif bearing an extracellular domain that facilitates ligand binding; a hydrophobic m...

Ngày tải lên: 09/08/2014, 07:20

... ELISA kits (Biosource, Camarillo, CA, USA), in accordance with the manufac- turer's instructions. Statistical analysis Statistical analysis was performed using the Statview soft- ware (Abacus ... Birbara CA, Teoh LA, Fischkoff SA, Chartash EK: Adalimu- mab, a fully human anti-tumor necrosis factor alpha mono- clonal antibody, for the treatment of rheumatoid arthritis in patie...

Ngày tải lên: 09/08/2014, 06:22

... transferase- mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine. Acknowledgements This work was supported by grants ... therapy using viral vectors is an attracti ve alternative approach to cancer therapy, with the potential to give therapeutic ratios superior to standard chemo- and radiotherapy [10]. Th...

Ngày tải lên: 18/06/2014, 19:20

... of infection; ELISA: enzyme-linked immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferase- mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; ... liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5). Taking all these data into consideration, it appears t hat combina- tion therapy of Ad...

Ngày tải lên: 20/06/2014, 03:20

... less than 1 cm where possible. Volume of residual disease was not availabe. Standard adjuvant therapy was combination of paclitaxel and platinum-based chemotherapy. Median age at diagnosis was 62 ... homeostasis and androgen receptor (AR) activity have been implicated in ovarian carcinogenesis but the relationship between AR expression in ovarian cancer and clinical outcome remains un...

Ngày tải lên: 20/06/2014, 07:20

... Psychiatry 1971, 34, 415-426. 15. Iwane M, Kitamura Y, Kaisho Y, Yoshimura K, Shintani A, Sasada R, Nakagawa S, Kawahara K, Nakahama K, Kakinuma A. Production, purification and characterization ... DNA was synthesized artificially based on the sequence of the predicted Canis familiaris nerve growth factor beta (5′-ATGTCCATGTTGTTCTACACTCTGAT CACAGCTCTTCTGATCGGCATCCGGGCAGAACC GCATCCAGAGA...

Ngày tải lên: 07/08/2014, 23:22

... analysis Phylogenetic analysis of zebrafish fabp4 and fabp3 and other fish and mammalian FABP genes was performed using clustalx [43]. The Antarctic fish H6-FABP and H8- FABP sequences were included in this analysis, ... Phylogenetic analysis clustered the zebrafish FABP4 with all Antarctic fish H6-FABPs and putative FABP4s from other fishes in a single clade, and then with the mammalian...

Ngày tải lên: 07/03/2014, 10:20

... codes, so additional information was used: location, name and country. Each additional station was compared with the stations already in the database, both to avoid unnecessary duplication and to ... (2005) CLIMATE DATABASE CONSTRUCTION 711 they are widespread. This method also has none of the advantages of a manual method; an automated method is essential to handle such large quantit...

Ngày tải lên: 30/03/2014, 13:20