Báo cáo khoa học: " Differential protection by wildtype vs organelle-specific Bcl-2 suggests a combined requirement of both the ER and mitochondria in ceramide-mediated caspase-independent programmed cell death" docx

Báo cáo khoa học: " Differential protection by wildtype vs. organelle-specific Bcl-2 suggests a combined requirement of both the ER and mitochondria in ceramide-mediated caspase-independent programmed cell death" docx

Báo cáo khoa học: " Differential protection by wildtype vs. organelle-specific Bcl-2 suggests a combined requirement of both the ER and mitochondria in ceramide-mediated caspase-independent programmed cell death" docx

... induction of both apop- tosis [15] and ciPCD [2,12,13]. In fact, the ER may play a key role in certain types of ciPCD, as intracellular calcium influx caused by ER stress induces activation of calpains, ... of ceramide-mediated caspase-independent programmed cell death. This also implicates the participation of both (or all three) organelles in the...

Ngày tải lên: 09/08/2014, 10:20

9 388 0
Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx

Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx

... enhance cell attachment. For the invasion assay, the inserts were coated with extracellular matrix gel from Engelbreth–Holm–Swarm mouse sarcoma (Sigma, Santa Clara, CA, USA). On the following day, ... buds. Cell monolayers on the lower surface of the insert were fixed and stained using standard cytological techniques. Six visual field of each insert were randomly counted und...

Ngày tải lên: 07/03/2014, 00:20

8 537 0
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

... kept in artificial seawater at 25 ± 1 °C under a 12 h light ⁄ dark cycle in the Sea Water Facility of the Department of General Zoology and Endocrinology at the University of Ulm. Experiments involving ... first had to verify that green-to-red conversion of mcavRFP and EosFP occurs only via photoinduction and not in any other way in the tissues of the corals...

Ngày tải lên: 30/03/2014, 09:20

10 487 0
Báo cáo khoa học: " Early observed transient prostate-specific antigen elevations on a pilot study of external beam radiation therapy and fractionated MRI guided High Dose Rate brachytherapy boost" doc

Báo cáo khoa học: " Early observed transient prostate-specific antigen elevations on a pilot study of external beam radiation therapy and fractionated MRI guided High Dose Rate brachytherapy boost" doc

... 30,000 deaths each year from prostate cancer [1]. External beam radiation therapy (EBRT) and/ or brachytherapy are main- stays of local therapy. Low dose rate (LDR) brachytherapy, with permanently implanted ... confirm adequate perineal access and the absence of pubic arch interference. Adju- vant hormonal or experimental PSA vaccine therapy was permitted at the discretion of th...

Ngày tải lên: 09/08/2014, 10:21

5 383 0
Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

... transcriptional activity of various hHSF4–VP16 derivatives (Fig. 4A, B). Human HSF4 contains a DBD at the N-terminus, HR -A and HR-B in the central region, and a relatively weak activation domain at the C-terminus ... Sakurai 1 1 Department of Clinical Laboratory Science, Kanazawa University Graduate School of Medical Science, Japan 2 Department of Ophthalmology and...

Ngày tải lên: 07/03/2014, 00:20

13 508 0
Báo cáo khoa học: Differential membrane compartmentalization of Ret by PTB-adaptor engagement pdf

Báo cáo khoa học: Differential membrane compartmentalization of Ret by PTB-adaptor engagement pdf

... via interac- tion with adaptor proteins. Several phosphotyrosine- binding domain-containing adaptors (PTB adaptors) compete for interaction with Tyr1062, but only one adaptor may interact at any ... can be temporally and quantita- tively affected by activation within or outside DRM fractions [23]. To examine the role of the PTB adaptors in the activation of the MAPK and Ak...

Ngày tải lên: 07/03/2014, 05:20

12 431 0
Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf

Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf

... compared the binding of FITC-labelled VT1B and native VT1B to the series of deoxyGb 3 analogues by TLC overlay. Separate binding assays were visualized using either the anti-FITC peroxidase or the ... 2004 Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody Role in human renal glomerular binding Davin Char...

Ngày tải lên: 16/03/2014, 16:20

13 398 0
Báo cáo khoa học: Differential regulation of fatty acid amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone pdf

Báo cáo khoa học: Differential regulation of fatty acid amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone pdf

... transfection efficiency, and for protein quantitation. CAT activity was determined using the Quan-T-CAT assay system (Amersham Life Sciences), whereas the activity of b-gal was assayed using the b-Galactosidase Enzyme ... amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone Mauro Maccarrone 1,2 , Valeria Gasperi 3 , Filomena Fezza 1 , A...

Ngày tải lên: 30/03/2014, 15:20

11 469 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... patterns were also observed, includ- ing that Mxi1-SRa appears to be the predominant transcript in the adult intestine and in the developing embryo, whereas Mxi1-SRb transcripts predominate in the ... Myc antagonism in the REF assay, subcellular localization, and transcrip- tional activity. Some of these analyses have assigned differential functions to the two isof...

Ngày tải lên: 18/02/2014, 16:20

11 587 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... outer reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... (bp) Northern blot & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R) 2 reverse GAAGGCACGCTGAGGAAGAC A1 R 5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCT...

Ngày tải lên: 19/02/2014, 02:20

11 663 0
w