0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

... Silverman and R. Linsker, A measure of DNA periodic-ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300,1986.[23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya,and ... like to thank two anonymous reviewers for a number of helpful suggestions, which have certainlyimproved the quality of this paper. Thanks are also due toProfessor Eliathamby Ambikairajah for helpful ... periodicity,as discussed above for TATA tetramers. In this example,the hybrid autocorrelation-IPDFT result is biased towardsthe IPDFT, as a result of the IPDFT having a largerdynamic range than the autocorrelation....
  • 8
  • 382
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... typically smaller for ANFIS-generatedplans (by an average of 7.4%). Comparing ANFIS andoFIS for the same cases, PTV coverage was somewhat infe-rior for ANFIS generated plans, although this was a minordifference ... the dose to brain stem, oFIS and ANFIS showedDVH Comparison of ANFIS and manual planning for a prostate caseFigure 4DVH Comparison of ANFIS and manual planning for a prostate case.01020304050607080901000 ... vs.human planner and 3% for ANFIS vs. oFIS was achieved. For PTV coverage an improvement of 1.5% for ANFIS vs.human planner and a reduction of -1.75% for ANFIS vs.oFIS was observed.Several factors...
  • 16
  • 510
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SenseRelate::TargetWord – A Generalized Framework for Word Sense Disambiguation" doc

... lexical sample format, which is anXML–based format that has been used for both theSENSEVAL-2 and SENSEVAL-3 exercises. A file inthis format includes a number of instances, each onemade up of ... sub-tasksor stages accepts data from a previous stage, per-forms a transformation on the data, and then passeson the processed data structures to the next stage inthe pipeline. We have created ... Dis-ambiguation that uses Machine Readable Dictionar-ies, and are highly related to our approach.One of the first approaches was that of (Lesk,1986), which treated every dictionary definition of a...
  • 4
  • 349
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot

... rules and a default mechanism are given for the evaluation of DATR queries. Their precise semantics and properties are described in (Evans/Gazdar, 1989b; 1990). A major feature of DATR is ... regularities using default inheritance, and exceptions, overriding. DATR axioms consist of node-path pairs associated with a right-hand side. This can be a value (atomic or lis0, or an evaluable ... the global environ- ment is changed in the course of the evaluation. As a declarative language, DATR is independent of the procedural evaluation strate- gies embodied in particular DATR-implementa-...
  • 6
  • 388
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Evaluating CETEMPublico, a free resource for Portuguese" doc

... http://info.ox.ac.uk/bnc/performed validation checks. The same happens for corpora that have been manually revised.As regards sentence separation, Johansson etal. (1996) mention that proofreading of theautomatic ... several critical remarks are not out of place: 5 We have no estimate of how many users have actuallysucceeded, or even tried, to apply the patches madeavailable later on. We have just launched ... comments.ReferencesSusana Cavadas Afonso and Ana Raquel Marchi.2001. Critérios de separação de sentenças/frases,cgi.portugues.mct.pt/treebank/CriteriosSeparacao.htmlJ.J. Almeida and Ulisses Pinto....
  • 8
  • 362
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Optimistic Backtracking A Backtracking Overlay for Deterministic Incremental Parsing" ppt

... ranking of candidatetransitions.Treating backtracking as a ranking problem hasseveral attractive features. It may combine globaland local syntactic and semantic information relatedto each ... list of applicablecandidates, and the number of remaining tran-sitions, relative to the list of candidates• the last lexical tag and part -of- speech tag thatwere processed before parsing failure• ... only method thatapplies ranking rather than some probability-basedalgorithm for backtracking. This aspect is critical for classification-based parsing oracles that do notyield a probability score...
  • 6
  • 364
  • 1
báo cáo hóa học:

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... TCGTATTCATACACCGTACPEx1F CCAATTGCGCTACGCTCCT DNA-shift assay PSEx1PEx1R CCATGTAGGCGGTGACGAsimA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTCPEx2F ACTTCCCAGAAGTA DNA-shift ... TAGAATTCATCGCCACGACCATG DNA-shift assay PR1SD2R1R TAGAATTCCGCGGTTCGGCAGAsimX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3simX5D3R TAGAATTCGCGACAGGAGCCATAsimEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay ... nameSSR1F ATACCATGGCCCGTGAACGT SimReg1 simReg1SSR1R TTTGAATTCATTAATGGTGATGGT purificationSR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay PD4SR1D4R TAGAATTCCATTGTGAACCATCSD2R1F TAGAATTCATCGCCACGACCATG...
  • 12
  • 454
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

... inpainting techniques that are not suitable for large areas2 EURASIP Journal on Image and Video ProcessingAntiabrasionAdhesiveEmulsionBaseAnticurlAntihalationSilver halidecrystal grainLayer ... important items at risk. This hascreated an urgent need for a technique that can capture theinformation in each of the negatives of a large collectionbefore the damage causes a complete and ... 1997.[36] E. Prados, F. Camilli, and O. Faugeras, A unifying andrigorous shape from shading method adapted to realistic dataand applications,” Journal of Mathematical Imaging and Vision,vol....
  • 13
  • 569
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx

... composed of 13 identical 1.5-bit stages.Eachstagehasgainerrorswithavarianceof1%,offset errors (for the MDAC and the comparators) of 1%, and third-ordernonlinearity at the output of the MDAC stage ... comparesour technique with other proposed techniques which addressthe same problem.2. STANDARD DIGITAL BACKGROUND CALIBRATION A pipeline ADC is composed of a cascade of stages that per-form an ... theinput signal sample is contained in certain intervals, so thatmany samples may be useless for the parameter estimation.However, this technique requires additional capacitors, withan increase in...
  • 11
  • 398
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hypofractionated radiotherapy after conservative surgery for breast cancer: analysis of acute and late toxicity" ppt

... UK Standardisation of Breast Radiotherapy(START) Trial B of radiotherapy hypofractionation for treatment of earlybreast cancer: a randomised trial. Lancet 2008, 371:1098-17.7. International ... Standardisation of Breast Radiotherapy(START) Trial A of radiotherapy hypofractionation for treatment of earlybreast cancer: a randomised trial. Lancet 2008, 9:331-41.6. The START Trialists’ Group: ... krengli@med.unipmn.it1Department of Radiotherapy, University Hospital Maggiore della Carità,Novara, ItalyFull list of author information is available at the end of the articleDeantonio et al. Radiation Oncology...
  • 7
  • 387
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam