Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf

Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf

Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf

... Oncology Open Access Research Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study James A Tanyi* 1,2 , ... impact of two multileaf collimator (MLC) systems (2.5 and 5 mm leaf widths) on three-dimensional conformal radiotherapy, inten...

Ngày tải lên: 09/08/2014, 10:20

7 239 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... PRMTs catalyze monomethylation as a reaction intermediate [4]. Post-translational modifications within T-cell-recep- tor signaling cascades allow T lymphocytes to initiate a rapid and appropriate ... diseases. As SAM is the methylation donor in the PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs. As a SAM analog, sinefungin can compe...

Ngày tải lên: 06/03/2014, 11:20

13 646 0
Báo cáo khoa học: " Effect of multi-planar CT image reformatting on surgeon diagnostic performance for localizing thoracolumbar disc extrusions in dogs" docx

Báo cáo khoa học: " Effect of multi-planar CT image reformatting on surgeon diagnostic performance for localizing thoracolumbar disc extrusions in dogs" docx

... volume data for interactive manipulation and visualization [5]. Reformatting software is a standard feature of most newer-generation CT scanner computers and is also available for purchase (e-Film; ... radiographic marker in MPR images was also mentioned. 228 Jason B. King et al. Fig. 5. Mean diagnostic certainty scores for each reader and eac h CT image display format, using...

Ngày tải lên: 07/08/2014, 23:22

8 328 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

... incubated with the secondary antibody for 1 h in 30 mL of 5% milk ⁄ NaCl ⁄ Tris; the secondary anti- body was affinity purified anti-rabbit IgG whole molecule alkaline phosphatase conjugate (purchased ... glycerol-3- phosphate dehydrogenase of Trypanosomatidae and the glycosomal redox balance of insect stages of Trypanoso- ma brucei and Leishmania spp. Mol Biochem Parasitol 149, 155...

Ngày tải lên: 23/03/2014, 04:21

11 513 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... of Parkinson’s disease [35]. It has recently been shown that the protective action of rasagiline, a MAO-B inhib- itor, on the aggregation of a- synuclein, is becau...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m ... GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w CAAGCAGGTGAATTAGGC Spcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC Spcoq7-...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and H...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... binding of CBC and Cbl, calculation of k + We have tested the application of the fluorescent ana- logue CBC as a tool for investigation of the binding kinetics of nonfluorescent ligands. Cyano-cobalamin (CNCbl) ... initial concentration of CBC constant. The same final amplitude of fluorescent response was reached after 30 s of incubation, there- fore the reactions obeyed an ir...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG TAGCTTGCACTCAG-3¢) containing a NcoI restriction site and 1 U of Pfu-polymerase. PCR amplification was carried out ... 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried out in a final volume...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... Gomez-Mouton C, Abad JL, Mira E, Lacalle RA, Gal- lardo E, Jimenez-Baranda S, Illa I, Bernad A, Manes S & Martinez AC (2001) Segregation of leading-edge and uropod components into specific lipid rafts ... groups as evaluated by BCh binding. Isolation of the BCh-bound membrane subpopu- lation from raft fractions and its evaluation We developed an isolation method for a raft subpopu...

Ngày tải lên: 20/02/2014, 03:20

10 589 0
w