Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt

Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt

Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt

... Access Research Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose -volume analysis Cem ... Vavassori V, Sanguineti G, Bianchi C, Cattaneo GM, Piaz- zolla A, Cozzarini C: Rectum contouring variability in patients treated fo...

Ngày tải lên: 09/08/2014, 09:22

7 333 0
Báo cáo khoa học: Modulation of IMPDH2, survivin, topoisomerase I and vimentin increases sensitivity to methotrexate in HT29 human colon cancer cells docx

Báo cáo khoa học: Modulation of IMPDH2, survivin, topoisomerase I and vimentin increases sensitivity to methotrexate in HT29 human colon cancer cells docx

... were obtained upon incubation with stepwise concentrations of MTX (Lederle, Madrid, Spain). cDNA arrays Gene expression was analyzed by hybridization to cDNA arrays (Atlas TM Human Cancer Array 1.2K ... NY, USA) for 7 days and scanned with a Storm 840 phosphorimager (Molecular Dynamics, Sunnyvale, CA, USA). Array data analysis Image analysis and quantification were carried out w...

Ngày tải lên: 07/03/2014, 16:20

15 422 0
Báo cáo khoa học: "Comparison of different bronchial closure techniques following pneumonectomy in dogs" doc

Báo cáo khoa học: "Comparison of different bronchial closure techniques following pneumonectomy in dogs" doc

... Dhillon R, Heath BJ. Air leaks after surgical stapling in lung resection: a comparison between stapling alone and stapling with staple-line re- inforcement materials in a canine model. J Thorac ... (arrow) with 2-0 vicryl following pneumonectomy. (B) Application of a TA-30 stapler to the main stem bronchus after pulmonary artery and vein ligation. (C) Transposition a...

Ngày tải lên: 07/08/2014, 20:23

7 244 0
Báo cáo khoa học: "Effects of Multiple-purpose Microorganic Compost B2006-32-21 on Paddy Rice in Degraded and Alluvial Soil in the North of Vietnam" potx

Báo cáo khoa học: "Effects of Multiple-purpose Microorganic Compost B2006-32-21 on Paddy Rice in Degraded and Alluvial Soil in the North of Vietnam" potx

... has a significant effect on paddy rice, such as increases of height, increases of number of ears, and reduction of pest and disease infections compared to chemical fertilizers alone. In particular, ... particular, applying MMC increased the yield of rice in the alluvial soil of the Red River Delta in Gia Lam (Hanoi) by 0.35 ton/ha and in degraded soil in Hi...

Ngày tải lên: 06/08/2014, 19:20

4 418 0
Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf

Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf

... SBRT of lung and liver lesions, and if potential gains realized may be clinically meaningful. Materials and methods Patients and treatment protocol The present study is based on 29 patients that ... The imaging data was electronically transferred to the Eclipse radiation therapy planning system (Varian Medical Sys- tems, Palo Alto, CA, USA). Based on both free-breathing and...

Ngày tải lên: 09/08/2014, 10:20

7 239 0
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

... initial increase in circulating plasma volume, its moderate duration of effect and its low incidence of anaphylactic reaction. Therefore, administration of a small- volume D40 should be confirmed ... signs, attrition, food and water intake, and urine and feces production. Clinical signs, such as moist rales on ausculation, moist cough, jugular vein congestion, ophthalmo...

Ngày tải lên: 07/08/2014, 18:21

6 366 0
Báo cáo khoa học: "Use of pressure volume curves in water relation analysis on woody shoots: influence of rehydration and comparison of four European oak species" ppsx

Báo cáo khoa học: "Use of pressure volume curves in water relation analysis on woody shoots: influence of rehydration and comparison of four European oak species" ppsx

... emphasized that variations within a given species are often larger than those between species, and that variations were related to leaf age, local stand conditions, and physiological adaptation ... symplasmic water content, and that the apoplastic and intercellular wa- ter content remain constant. Such a curve, as shown in figure 1, displays...

Ngày tải lên: 09/08/2014, 03:24

13 341 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

... antibody (claudin-3 antibody; Abcam, Cambridge, MA, USA; SLC2 5A4 mAb, Abnova, Taipei, Taiwan; HLA Class 1 A1 antibody, Abcam; Tapasin antibody, Abcam) at a dilution of 1 : 1000 for 2 h, followed by incubation ... conclusion that annexin A2 , annexin A4 and VDAC appear as poten- tial markers of interest for colorectal cancer diagnosis [19]. A recent report detecting the change...

Ngày tải lên: 16/02/2014, 15:20

11 590 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

... 1) gave rise to a 10-fold increase in K m and a corresponding decrease in k cat ⁄ K m , underscoring the importance of the interactions between the Tyr OH and the side chains of Asn174 and Asp148 ... con- centrations. The reaction mixture was incubated at 30 °C for 30 min, and the reaction was stopped by the addition of 160 lL 4.5 m guanidine hydrochloride containing 1%...

Ngày tải lên: 19/02/2014, 16:20

10 524 0
w