Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt
Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt
... AccessResearch Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose -volume analysisCem ... Vavassori V, Sanguineti G, Bianchi C, Cattaneo GM, Piaz-zolla A, Cozzarini C: Rectum contouring variability in patients treated for prostate cancer: impact on rectum dose -volume histograms and ... techniques of rectal contouring significantly influence the calculation of radiation doses to the rectum and the prediction of rectal toxicity. Rectal volume receiving higherdoses (≥ 70 Gy) and mean rectal...
- 7
- 333
- 0
Báo cáo khoa học: Modulation of IMPDH2, survivin, topoisomerase I and vimentin increases sensitivity to methotrexate in HT29 human colon cancer cells docx
... wereobtained upon incubation with stepwise concentrations of MTX (Lederle, Madrid, Spain).cDNA arraysGene expression was analyzed by hybridization to cDNAarrays (AtlasTMHuman Cancer Array 1.2K ... NY, USA) for 7 days and scanned with a Storm 840phosphorimager (Molecular Dynamics, Sunnyvale, CA,USA).Array data analysisImage analysis and quantification were carried out with Atlas image ... 5¢-TCACGAGCCAGCAAGGCGTT-3¢ within intron 1 and 5¢-ACGCAGTACTCATCCAGGGT-3¢ within intron 2.The dhfr copy number was calculated according to theratio of the dhfr and aprt signals for each MTX-resistantclone.RT-PCRLevels...
- 15
- 422
- 0
Báo cáo khoa học: "Comparison of different bronchial closure techniques following pneumonectomy in dogs" doc
... Dhillon R, Heath BJ. Air leaks after surgical stapling in lung resection: a comparison between stapling alone and stapling with staple-line re-inforcement materials in a canine model. J Thorac ... (arrow) with 2-0 vicryl following pneumonectomy. (B) Application of a TA-30 stapler to the main stem bronchus after pulmonary artery and vein ligation. (C) Transposition and suturing of the 4th inter-costal ... techniques, their histological healing patterns and possible cardiac, respiratory and gastro-intestinal system complications after pneumonectomy have not been compared experimentally and have only...
- 7
- 244
- 0
Báo cáo khoa học: "Effects of Multiple-purpose Microorganic Compost B2006-32-21 on Paddy Rice in Degraded and Alluvial Soil in the North of Vietnam" potx
... has a significant effect on paddy rice, such as increases of height, increases of number of ears, and reduction of pest and disease infections compared to chemical fertilizers alone. In particular, ... particular, applying MMC increased the yield of rice in the alluvial soil of the Red River Delta in Gia Lam (Hanoi) by 0.35 ton/ha and in degraded soil in Hiep Hoa (Bac Giang province) by 0.43 ton/ha. ... 0.86 kg of rice. With the total input of 500 kg of MMC for one ha of rice, an additional 430 kg of rice is expected. Taking into account the price of MMC and of rice, financially one VND invested...
- 4
- 417
- 0
Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf
... SBRT of lung and liver lesions, and if potential gains realizedmay be clinically meaningful.Materials and methods Patients and treatment protocolThe present study is based on 29 patients that ... Theimaging data was electronically transferred to the Eclipseradiation therapy planning system (Varian Medical Sys-tems, Palo Alto, CA, USA). Based on both free-breathing and respiration resolved ... responsible for dataacquisition and revised the manuscript. YC participated in the statistical analytical assessment of the data. CLM wasresponsible for data acquisition and revised the manu-script....
- 7
- 239
- 0
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx
... initial increase in circulating plasma volume, itsmoderate duration of effect and its low incidence of anaphylactic reaction. Therefore, administration of a small- volume D40 should be confirmed ... signs,attrition, food and water intake, and urine and fecesproduction. Clinical signs, such as moist rales on ausculation,moist cough, jugular vein congestion, ophthalmoptosis,salivation or arrhythmia ... al.kg. Healthy calves were selected on the basis of physicalexamination, electrocardiography and hematological analysis. A well-balanced growth diet consisting of pelletedconcentrated ration and...
- 6
- 366
- 0
Báo cáo khoa học: "Use of pressure volume curves in water relation analysis on woody shoots: influence of rehydration and comparison of four European oak species" ppsx
... emphasized that variationswithin a given species are often largerthan those between species, and thatvariations were related to leaf age, localstand conditions, and physiologicaladaptation ... symplasmic water content, and that the apoplastic and intercellular wa-ter content remain constant. Such a curve,as shown in figure 1, displays a linear re-gion where ... 0.54 and 0.26 MPa for Quercus alba, Q macro-carpa and Q stellata respectively (Parker and Pallardy, 1988b), 0.60, 0.23 and 0.13MPa for Q acutissima, Q alba and Q stel-lata...
- 13
- 341
- 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx
... antibody(claudin-3 antibody; Abcam, Cambridge, MA, USA;SLC2 5A4 mAb, Abnova, Taipei, Taiwan; HLA Class 1 A1 antibody, Abcam; Tapasin antibody, Abcam) at a dilution of 1 : 1000 for 2 h, followed by incubation ... conclusion thatannexin A2 , annexin A4 and VDAC appear as poten-tial markers of interest for colorectal cancer diagnosis[19]. A recent report detecting the changes of proteinprofiles associated ... molecule activity (collagen I alpha-1chain, collagen I alpha-2 chain, tubulin beta chain),molecular transducer activity (ITGB2, interferon-induced transmembrane protein 1, integrin alpha-6 and integrin...
- 11
- 590
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACGScCoq7-b CCCCCGGGGCCACTTTCTGGTGSpcoq7 -a GTACAAGCTTGTAAATTTTCGATGGSpcoq7-b CATAGAATTCTTGGTAATCSpcoq7-c AAAGTCGACATGTTGTCACGTAGACAGSpcoq7-w CAAGCAGGTGAATTAGGCSpcoq7-x...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc
... 1) gaverise to a 10-fold increase in Km and a correspondingdecrease in kcat⁄ Km, underscoring the importance of the interactions between the Tyr OH and the sidechains of Asn174 and Asp148 ... con-centrations. The reaction mixture was incubated at 30 °Cfor 30 min, and the reaction was stopped by the addition of 160 lL 4.5 m guanidine hydrochloride containing 1% tri-fluoroacetic acid. An aliquot ... Proteins were eluted with a lineargradient to 1 m NaCl over 30 column volumes. Relevantfractions were pooled and concentrated using an AmiconYM-10 membrane. The samples were fractionated on a HiPrep...
- 10
- 523
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP