Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt
Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt
... GP96 is over-expressed in oral cavity cancer and is a poor prognostic
indicator for patients receiving radiotherapy
Chien-Yu Lin
1,6
,
Ting-Yang Lin
2
,
Hung-Ming Wang
3
, Shiang-Fu Huang
4
,
... the article as it appeared upon acceptance. Fully formatted
PDF and full text (HTML) versions will be made available soon.
GP96 is over-expressed in ora...
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... GCGGCCGCCACCATGCATCATCACCATCAC
CATGTCAGCCGTTTTGAACAC
RPE65c-His-Fwd
NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC
CATGTCAGCCGTCTTGAACAC
Y. Takahashi et al. A novel isomerohydrolase in the retina
FEBS Journal 278 (2011) ... NA TGCARRAAYATHTTYTCCAG
Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA
RPE6 5a- Fwd
NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC
RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG
RPE65c-F...
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf
... such a distinction
is prevalent in many other sounds, some of which
are (a) nasals in Tamil (Shanmugam, 1972) and
Malayalam (Shanmugam, 1972; Ladefoged and
Maddieson, 1996), (b) laterals in Albanian ... inventories: A complex network ap-
proach. In COLING-08, pages 601–608.
J. R. Quinlan. 1993. C4.5: Programs for Machine
Learning. Morgan Kaufmann.
S. V. Shanmugam. 1972. De...
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx
... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T.,
Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification
of nucleolin as a binding protein for midkine (MK) and heparin-
binding ... nucleolin was generated by PCR amplification
using total first-strand cDNA as template and the following
oligonucleotides: 5¢-TGGTATGACTAGGAAATTTGGT
TATGTG-3¢ and 5¢-GACAGAAGCTATTCAAACTTC...
Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot
... ligand by the protein. In this analy-
sis, we have investigated the cases of donor (approach
of many acceptors towards a donor) and acceptor
(approach of many donors towards an acceptor) furca-
ted ... it is amazing to see a large number (> 50)
of such interactions in single proteins as in case of
enzymes carbamoyl phosphate synthetase, malate
synthase G (PDB code 1d8cA) and...
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
... ligand also changes, resulting in a nonproductive
binding mode. Our data indicate an important role for
the interactions between the CoA substrate sulfur
group and the thiolase active site in assuring ... and con-
taining Phe235) is coloured purple and the catalytic Cys89 is coloured dark blue. His156 at the entrance of the pantetheine-binding cavity is
coloured orange....
Báo cáo khoa học: "Foliation of spruce in the Giant Mts. and its coherence with growth and climate over the last 100 years" pdf
... sets and radial increment can be
considered a natural ageing effect probably caused by
age-related declining leaf area index and primary pro-
ductivity as, for example, described by Mencuccini and
Grace ... a loss of information and of mass
transfer from the assimilative apparatus.
It should be mentioned that there was no indication of
forest decline from the data obtained. A...
Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx
... of carcinoma
associated with ulcerative colitis is adenocarcinoma [2].
We report this case because of the fact that SCC,
instead of adenocarcinoma, on a background of ulcera-
tive colitis is a ... histolo-
gical type of carcinoma associated with ulcerative colitis
is adenocarcinoma [2]. We present a case of primary
rectal small cell carcinoma in a patient with a history of
u...
Báo cáo khoa học: "Does Doxycycline work in synergy with cisplatin and oxaliplatin in colorectal cancer?" ppt
... primers
used are – GAPDH Forward – 5'-AACTTTGGCATTGT-
GGAAGG-3' Reverse 5'-GGAGACAACCTGGTCCTCAG-3'
and Caspase-3 Forward -5'-TGTCATCTCGCTCTGGTACG-
3' Reverse -5'-AAATGACCCCTTCATCACCA-3'
The ... significant
difference in the caspase 3 activity in HT 29 cells treated
with cisplatin and oxaliplatin alone in comparison with
combination of cisplati...
báo cáo khoa học: " Assessing implementation difficulties in tobacco use prevention and cessation counselling among dental providers" potx
... Institute for Health and Welfare; 2009.
6. Helakorpi S, Laitalainen E, Uutela A: Health Behaviour and Health among
the Finnish Adult Population. The National Institute for Health and
Welfare; 2009.
7. ... detailed
information on the participants, the exclusion criteria,
and the setting.
Statistical analysis
Estimates of internal consistency were calculated for the
theoretical d...
Từ khóa: