Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

... GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherapy Chien-Yu Lin 1,6 , Ting-Yang Lin 2 , Hung-Ming Wang 3 , Shiang-Fu Huang 4 , ... the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. GP96 is over-expressed in ora...

Ngày tải lên: 09/08/2014, 09:21

24 275 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A novel isomerohydrolase in the retina FEBS Journal 278 (2011) ... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-F...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... such a distinction is prevalent in many other sounds, some of which are (a) nasals in Tamil (Shanmugam, 1972) and Malayalam (Shanmugam, 1972; Ladefoged and Maddieson, 1996), (b) laterals in Albanian ... inventories: A complex network ap- proach. In COLING-08, pages 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. De...

Ngày tải lên: 22/02/2014, 02:20

9 703 1
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T., Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification of nucleolin as a binding protein for midkine (MK) and heparin- binding ... nucleolin was generated by PCR amplification using total first-strand cDNA as template and the following oligonucleotides: 5¢-TGGTATGACTAGGAAATTTGGT TATGTG-3¢ and 5¢-GACAGAAGCTATTCAAACTTC...

Ngày tải lên: 07/03/2014, 15:20

15 509 0
Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

... ligand by the protein. In this analy- sis, we have investigated the cases of donor (approach of many acceptors towards a donor) and acceptor (approach of many donors towards an acceptor) furca- ted ... it is amazing to see a large number (> 50) of such interactions in single proteins as in case of enzymes carbamoyl phosphate synthetase, malate synthase G (PDB code 1d8cA) and...

Ngày tải lên: 07/03/2014, 17:20

14 421 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... ligand also changes, resulting in a nonproductive binding mode. Our data indicate an important role for the interactions between the CoA substrate sulfur group and the thiolase active site in assuring ... and con- taining Phe235) is coloured purple and the catalytic Cys89 is coloured dark blue. His156 at the entrance of the pantetheine-binding cavity is coloured orange....

Ngày tải lên: 16/03/2014, 04:20

13 473 0
Báo cáo khoa học: "Foliation of spruce in the Giant Mts. and its coherence with growth and climate over the last 100 years" pdf

Báo cáo khoa học: "Foliation of spruce in the Giant Mts. and its coherence with growth and climate over the last 100 years" pdf

... sets and radial increment can be considered a natural ageing effect probably caused by age-related declining leaf area index and primary pro- ductivity as, for example, described by Mencuccini and Grace ... a loss of information and of mass transfer from the assimilative apparatus. It should be mentioned that there was no indication of forest decline from the data obtained. A...

Ngày tải lên: 08/08/2014, 14:21

9 433 0
Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx

Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx

... of carcinoma associated with ulcerative colitis is adenocarcinoma [2]. We report this case because of the fact that SCC, instead of adenocarcinoma, on a background of ulcera- tive colitis is a ... histolo- gical type of carcinoma associated with ulcerative colitis is adenocarcinoma [2]. We present a case of primary rectal small cell carcinoma in a patient with a history of u...

Ngày tải lên: 09/08/2014, 03:23

5 478 0
Báo cáo khoa học: "Does Doxycycline work in synergy with cisplatin and oxaliplatin in colorectal cancer?" ppt

Báo cáo khoa học: "Does Doxycycline work in synergy with cisplatin and oxaliplatin in colorectal cancer?" ppt

... primers used are – GAPDH Forward – 5'-AACTTTGGCATTGT- GGAAGG-3' Reverse 5'-GGAGACAACCTGGTCCTCAG-3' and Caspase-3 Forward -5'-TGTCATCTCGCTCTGGTACG- 3' Reverse -5'-AAATGACCCCTTCATCACCA-3' The ... significant difference in the caspase 3 activity in HT 29 cells treated with cisplatin and oxaliplatin alone in comparison with combination of cisplati...

Ngày tải lên: 09/08/2014, 04:20

8 252 0
báo cáo khoa học: " Assessing implementation difficulties in tobacco use prevention and cessation counselling among dental providers" potx

báo cáo khoa học: " Assessing implementation difficulties in tobacco use prevention and cessation counselling among dental providers" potx

... Institute for Health and Welfare; 2009. 6. Helakorpi S, Laitalainen E, Uutela A: Health Behaviour and Health among the Finnish Adult Population. The National Institute for Health and Welfare; 2009. 7. ... detailed information on the participants, the exclusion criteria, and the setting. Statistical analysis Estimates of internal consistency were calculated for the theoretical d...

Ngày tải lên: 10/08/2014, 10:23

10 340 0
Từ khóa:
w