Báo cáo khoa học: "Breathing adapted radiotherapy: a 4D gating software for lung cancer" pdf

... this article as: Peguret et al.: Breathing adapted radiotherapy: a 4D gating software for lung cancer. Radiation Oncology 2011 6:78. Submit your next manuscript to BioMed Central and take full advantage ... Kunieda T, Kitamura K, van Herk M, Kagei K, Nishioka T, Hashimoto S, Fujita K, Aoyama H, Tsuchiya K, Kudo K, Miyasaka K: Physical aspects of a real-time tumor-tracking sy...

Ngày tải lên: 09/08/2014, 09:20

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC 2– G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC 1– GGGC aagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG 2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTG...

Ngày tải lên: 17/03/2014, 03:20

... like aufh6ren ('stop'), illustrated in (1). (1) a. Anna glaubt, dass Bernard aufh6rt. ('Anna believes that Bernard stops') b. Claudia h6rt jetzt auf. ('Claudia stops ... the last line mark the absence of a line break in the actual code. Feature specifications separated by tabs refer to sets of formatives in paradigmatic variation. Each line thus generates on...

Ngày tải lên: 17/03/2014, 07:20

... was 42.3 min. Total yield of thiocora- line was 1.6 mgÆL )1 culture. DNA-bisintercalation activity assay Oligonucleotides AS1 5¢-AATATACGTTCGATTAA-3¢ and AS2 3¢-TTATATGCAAGCTAATT-5¢ were synthe- sized ... characteriza- tion and antitumor activity. J Antibiot 33, 1087–1097. 25 Okada H, Suzuki H, Yoshinari T, Arakawa H, Okura A, Suda H, Yamada A & Uemura D (1994) A new topoisomerase II...

Ngày tải lên: 23/03/2014, 06:20

... not readily available (Zhao et al., 2010). In contrast, bilingual parallel data is in abundance and has been used in extracting paraphrase (Ban- nard and Callison-Burch, 2005; Zhao et al., 2008b; Callison-Burch, ... issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase changes less gets larger BLEU score and the evaluations of paraphrase quality and rate te...

Ngày tải lên: 23/03/2014, 14:20

... standard methods and analyzed with a microscope, BZ-8100 (Key- ence, Osaka, Japan). Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions. ... situ activity in skin and hair follicles Asaka Yamane 1, *, Mina Fukui 1, *, Yoshiaki Sugimura 1 , Miho Itoh 1 , Mileidys Perez Alea 2 , Vincent Thomas 2 , Said El Alaoui...

Ngày tải lên: 29/03/2014, 21:20

... theories into machine learning-based approaches. A typical machine learning-based approach to zero-anaphora resolution searches for an an- tecedent in the set of candidates appearing in all the preceding ... have been recently increasing concerns with the need for anaphora resolution to make NLP applications such as IE and MT more reli- able. In particular, for languages such as Japan...

Ngày tải lên: 30/03/2014, 23:20

... Lactation, Growth, Adaptation, Disease, and Parasite Resistance, Lincoln, Nebraska, 1986, pp. 345–354. [8] Gelman A. , Carlin J.B., Stern H.S., Rubin D.B., Bayesian Data Analysis, Chap- man & ... was similar for Large White and French Landrace pigs, the pattern shown for the permanent environmental variance was different and less regular than for the genetic variance. This also had...

Ngày tải lên: 09/08/2014, 18:21

Ngày tải lên: 09/08/2014, 18:21

... whole antibody; Amersham Pharmacia Biotech). MRP1 and cave- olin expression were evaluated after densitometric scanning of film and analysis with image j 1.30 software. Localization of GM1 ganglioside GM1 ... caveolin-1, caveolin-2 and caveolin-3, caveolin-1 is the predominant isoform responsible for this structure and is used as a biochemical marker of caveolae [25,26]. It now seems cle...

Ngày tải lên: 30/03/2014, 09:20