Báo cáo khoa học: "Intraoperative radiation therapy for advanced cervical metastasis: a single institution experience " pot

... 13:107-111. doi:10.1186/1748-717X-6-72 Cite this article as: Zeidan et al.: Intraoperative radiation therapy for advanced cervical metastasis: a single institution experience. Radiation Oncology 2011 6:72. Submit your next manuscript ... IORT. Keywords: intraoperative radiotherapy, IORT, cervical metastasis Background The management of advanced or recurrent cervical...

Ngày tải lên: 09/08/2014, 09:20

... immediately after lumpectomy. Intraop- erative radiation therapy (IORT) allows the patient to receive all her radiation in a single fraction before she awakens from surgery. Additional potential advantages include ... alternative methods of delivering radiation therapy have been explored. In contrast to standard EBRT, which treats the whole breast, accelerated partial breast irr...

Ngày tải lên: 09/08/2014, 04:21

... 0 4,6 max (Gy/GyE) median (Gy/GyE) contralateral lens ipsilateral mandibular joint contralateral mandibular joint ipsilateral parotid contralateral parotid ipsilateral eye contralateral eye C12 ... intensity-modulated radiation therapy for cancers of the paranasal sinuses, nasal cavity, and lacrimal glands: technique, early outcome, and toxicity. Head Neck 2008, 30:925-932. 19. Madani I...

Ngày tải lên: 09/08/2014, 09:20

... advanced melanoma in order to identify prognos- tic factors. We tried to assess whether adjuvant radiation therapy was advantageous in locally advanced melanoma, which minimal dose and radiation regimen ... treated for axillary LN metastasis and 15 patients (39.5%) for inguinal LN metastasis had grade 2 toxicity. Toxicity rates were 9% grade 1 and 9% grade 2 for cervical, 20%...

Ngày tải lên: 09/08/2014, 09:20

... 9. Daramola JO, Abioye AA, Ajagbe HA, Aghadiuno PU: Maxillary malignant ameloblastoma with intraorbital extension: report of a case. J Oral Surg 1980, 38:203-206. 10. Lee L, Maxymiw WG, ... carcinomas receiving ra diation therapy are scarce and mostly from the pre-3 D and cobalt era [9-11]. To our knowledge, radiotherapy has only been given as adjuvant therapy in only a few cases [11-...

Ngày tải lên: 09/08/2014, 09:20

... increased character accuracy to the relat ive increased MAP for the three lexicon adaptation ap- proaches are different. A key factor making the proposed LAICA approach advantageous is that we ... replaced by characters, we can treat words as a means to enhance character recog- nition accuracy. Such arguments stand at least for Chinese ASR since they evaluate on character error rate a...

Ngày tải lên: 20/02/2014, 07:20

... DNA, includ- ing a C-terminal HA tag, using primers 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ ... QuikChange site-directed mutagenesis (Stratagene, La Jolla, CA, USA). The mutagenic primers used to construct MscL R135C were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTG...

Ngày tải lên: 07/03/2014, 02:20

... Translation, Montreal, Canada. Frank Smadja, Kathleen McKeown, and Vasileios Hatzsivas- siloglou. 1996. Translating collocations for bilingual lexi- cons: A statistical approach. Computational ... the Fourth Darpa Workshop on Speech and Natural Language, Asilomar. William A. Gale and Kenneth W. Church. 1993. A program for aligning sentences in bilingual corpora. Computation...

Ngày tải lên: 08/03/2014, 05:21

... Classification The weakly supervised learner returns a labelled data set for each class, from which a classifier can be trained. We can easily derive a classifier using the estimates from our learning ... projection and a committee of SVM classifiers is used in a hybrid co/self-training strategy for weakly supervised re- lation classification and (Chen et al., 2006) where a graph b...

Ngày tải lên: 23/03/2014, 18:20

... restaurants. Above has good decor, and Carmine’s has decent decor. Above and Carmine’s have good service. Above is a New American restaurant. On the other hand, Carmine’s is an Italian restau- rant. 2.5 ... under- goes the participial formation must have a have- possession predicate. In the example above, for instance, the Above is a New American restau- rant clause cannot undergo par...

Ngày tải lên: 23/03/2014, 19:20