Báo cáo khoa học: "Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparison" docx
Báo cáo khoa học: "Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparison" docx
... dosimetric
benefit of IMRT compared to 3D-CRT for the whole
breast in early breast cancer p atients. Data about t he
impact of IMRT on the adjuvant radiotherapy of the
chest wall in postmastectomy patie nts are ... 6:26
http://www.ro-journal.com/content/6/1/26
Page 7 of 7
RESEARCH Open Access
Tangential beam IMRT versus tangential beam
3D-CRT...
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx
... biotin and the target proteins,
and thus allows their analysis by SDS ⁄ PAGE.
Subcellular fractionation of porcine striatal brain
tissue
Porcine brain cut in half in the saggital plane was obtained
fresh ... Because of
the a- syn-mediated effect on DA uptake, abnormal
function or aggregation of a- syn in dopaminergic neu-
rons may affect the DA balance, and thereby incre...
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... GIF, in
1991, sparked considerable interest in understanding
the role of all MTs in the brain, and particularly
within the injured or diseased brain. In the case of
GIF, the protein has many neuroprotective ... Kohmura E, Sakaki T, Nonaka M,
Yamada K, Yamashita T, Kishiguchi T, Sakaguchi T &
Hayakawa T (1997) Expression of growth inhibitory
factor mRNA after focal...
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... evaluating the in uence of
Table 2. Thermodynamic parameters of the thermal denaturaturation of the different onconase (ONC) variants at 25 °C and pH 2.0. (C
Gdm/HCl
)
½
13
,
midpoint of guanidinium ... M., Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F.
(1991) Comparative base specificity, stability, and lectin activity of
two lectins from eggs of Rana catesbeiana an...
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p
Bottom
O1
O2
O2
cl
O3
O2
cro
O1
O1
+––
–140
5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA
GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT
ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT
TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA
AGTAGGTTTTGTAAGCGGGAGGTGACAACATG
TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTA
CTTGAGTCA
Sy...
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... However, the
position of the samples in Fig. 4A is in uenced by
the level of all variables in these samples. For example,
the samples of the strains in the third quadrant of
Fig. 4A have a tendency ... in the two PCs. The variables in the third
quadrant are all negatively correlated to NADPH in
the two PCs. The variables in the fourth quadran...
Báo cáo khoa học: Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence ppt
... common to all D isoforms.
Mutational analysis of DNS indicated that two separ-
ate regions in DNS, the N-terminal seven amino acids
and the two C-terminal amino acids, are essential for
nuclear import ... Nakashima K, Hagiwara T & Yamada M (2002)
Nuclear localization of peptidylarginine deiminase V
and histone deimination in granulocytes. J Biol Chem
277, 49562–49568.
44 Adam...
Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx
... are located in the United States,
and who maintain an approval rating of at least 90%.
Turkers are allowed a maximum of 30 minutes to
work on the HIT, and are paid one US dollar for an
accepted ... Turk
Crowdsourcing services such as AMT have made
large-scale data annotation and collection efforts fi-
nancially affordable by granting anyone with ba-
sic programming skills access to...
Báo cáo khoa học: Ligand binding promotes prion protein aggregation – role of the octapeptide repeats potx
... top of the gradient.
Fig. 2. Characterization of the heparin enhanced aggregation of
rPrP. (A) Comparison of the aggregation of rPrP enhanced by hepa-
rin, low molecular mass heparin (LMW heparin, ... that
an increase in the number of octapeptide repeats
causes conformational changes at the N-terminus,
resulting in an enhancement in the binding of PrP
ligands,...
Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf
... extract. Coomassie staining
of the SDS–PAGE gel showed a very prominent
change in the binding profile of protein bands migra-
ting in the 60 kDa range (boxed area, Fig. 1C). In
particular, the intensity ... correction of aberrant splicing caused by activation
of cryptic splice sites. J Hum Genet 52, 891–897.
27 Garcia-Blanco MA, Baraniak AP & Lasda EL (2004)
Alterna...