0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparison" docx

Báo cáo khoa học:

Báo cáo khoa học: "Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparison" docx

... dosimetric benefit of IMRT compared to 3D-CRT for the whole breast in early breast cancer p atients. Data about t heimpact of IMRT on the adjuvant radiotherapy of the chest wall in postmastectomy patie nts are ... 6:26http://www.ro-journal.com/content/6/1/26Page 7 of 7RESEARCH Open Access Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparisonVolker ... breast cancer patients an opposed tangential beam IMRT planand a standard opposed tangentia l beam 3D-CRT planwas generated for the radiotherapy of the chest wall. Thirteen patients had right-sided...
  • 7
  • 311
  • 0
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx

... biotin and the target proteins,and thus allows their analysis by SDS ⁄ PAGE.Subcellular fractionation of porcine striatal braintissuePorcine brain cut in half in the saggital plane was obtainedfresh ... Because of the a- syn-mediated effect on DA uptake, abnormalfunction or aggregation of a- syn in dopaminergic neu-rons may affect the DA balance, and thereby increaseoxidative stress in the ... plasma membrane DAT was highest in p2 5a- express-ing cells. Quantification of the data showed that p2 5a stimulated a significant ( 50%) increase in plasmamembrane DAT, in contrast to the significant...
  • 13
  • 596
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

... GIF, in 1991, sparked considerable interest in understanding the role of all MTs in the brain, and particularlywithin the injured or diseased brain. In the case of GIF, the protein has many neuroprotective ... Kohmura E, Sakaki T, Nonaka M,Yamada K, Yamashita T, Kishiguchi T, Sakaguchi T &Hayakawa T (1997) Expression of growth inhibitoryfactor mRNA after focal ischemia in rat brain. J CerebBlood ... within the brain. Furthermore, the discovery and continued investigation of this brain-spe-cific MT isoform has led to intense interest in the roles of the entire MT family in the brain, with particularfocus...
  • 9
  • 664
  • 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... evaluating the in uence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different onconase (ONC) variants at 25 °C and pH 2.0. (CGdm/HCl)½13,midpoint of guanidinium ... M., Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F.(1991) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeiana and R. japonica and liverribonuclease ... of AAP, as described in the Materials and methods. Completion of the hydrolysis wasconfirmed by the disappearance of the (Met1)-ONC(M23L) signal in the MALDI-TOF mass spectra 1 h after the addition...
  • 9
  • 704
  • 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTACTTGAGTCASynthesis of O1 DNAIIa ATTCAACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTASynthesis of O2 andO1O2 DNAsIIb TACTTGAGTCAACATAAAAGTTTGCTTTTCGTGTATTTTTTTGTTGAATSynthesis of O2 DNAPCI51 ... PurposepHC1 GGATCCTAAATCTTCTTGAGTAC Synthesis of O andO1O2 DNAspHC2 GAATTCTTGGTTCTATAGTATCTG Synthesis of O DNAPCR11 GACTCAAGTACACGTATCGTGTATAGTAGGTTTASynthesis of O1DNAPCR21 AAACCTACTATACACGATACGTGTACTTGAGTCASynthesis...
  • 11
  • 432
  • 0
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx

Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx

... However, the position of the samples in Fig. 4A is in uenced by the level of all variables in these samples. For example, the samples of the strains in the third quadrant of Fig. 4A have a tendency ... in the two PCs. The variables in the thirdquadrant are all negatively correlated to NADPH in the two PCs. The variables in the fourth quadrant aremainly positively correlated to NADPH, because ... concentration of NADP and NAD had a tendency to be increased in Gnd20, which might counterbalance the regulatoryeffect of the high NADPH concentration. The lack of a significant increase in NADH parallel...
  • 13
  • 382
  • 0
Báo cáo khoa học: Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence ppt

Báo cáo khoa học: Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence ppt

... common to all D isoforms.Mutational analysis of DNS indicated that two separ-ate regions in DNS, the N-terminal seven amino acidsand the two C-terminal amino acids, are essential fornuclear import ... Nakashima K, Hagiwara T & Yamada M (2002)Nuclear localization of peptidylarginine deiminase Vand histone deimination in granulocytes. J Biol Chem277, 49562–49568.44 Adam SA, Marr RS & ... either of the last two C-terminal amino acids PYcompletely abolished the in vivo and in vitro nuclearimport activity as well as the binding to Trn-1. Ala-nine scanning mutagenesis of the sequence...
  • 13
  • 338
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx

... are located in the United States,and who maintain an approval rating of at least 90%.Turkers are allowed a maximum of 30 minutes towork on the HIT, and are paid one US dollar for anaccepted ... TurkCrowdsourcing services such as AMT have madelarge-scale data annotation and collection efforts fi-nancially affordable by granting anyone with ba-sic programming skills access to a marketplace of anonymous ... research. Pew Internet& American Life Project Report.N. Jindal and B. Liu. 2008. Opinion spam and analysis. In Proceedings of the international conference on Websearch and web data mining,...
  • 11
  • 464
  • 0
Báo cáo khoa học: Ligand binding promotes prion protein aggregation – role of the octapeptide repeats potx

Báo cáo khoa học: Ligand binding promotes prion protein aggregation – role of the octapeptide repeats potx

... top of the gradient.Fig. 2. Characterization of the heparin enhanced aggregation of rPrP. (A) Comparison of the aggregation of rPrP enhanced by hepa-rin, low molecular mass heparin (LMW heparin, ... thatan increase in the number of octapeptide repeatscauses conformational changes at the N-terminus,resulting in an enhancement in the binding of PrPligands, such as GAG, eventually leading ... mAb 8H4. Blue dextran(Sigma) with a molecular mass of 2000 kDa was used as a marker in the gradient.Statistical analysis A two-way ANOVA program was used to determine the P-value between various...
  • 12
  • 362
  • 0
Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf

Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf

... extract. Coomassie staining of the SDS–PAGE gel showed a very prominentchange in the binding profile of protein bands migra-ting in the 60 kDa range (boxed area, Fig. 1C). In particular, the intensity ... correction of aberrant splicing caused by activation of cryptic splice sites. J Hum Genet 52, 891–897.27 Garcia-Blanco MA, Baraniak AP & Lasda EL (2004)Alternative splicing in disease and therapy. ... nuclear extract protein binding profile of WT, del _a and del_c RNAs followingCoomassie staining. The boxed area shows the protein bands that display the greatest change in binding profile. (D) Western...
  • 8
  • 439
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ