Báo cáo khoa học: "Tangential beam IMRT versus tangential beam 3D-CRT of the chest wall in postmastectomy breast cancer patients: A dosimetric comparison" docx
... dosimetric benefit of IMRT compared to 3D-CRT for the whole breast in early breast cancer p atients. Data about t he impact of IMRT on the adjuvant radiotherapy of the chest wall in postmastectomy patie nts are ... 6:26 http://www.ro-journal.com/content/6/1/26 Page 7 of 7 RESEARCH Open Access Tangential beam IMRT versus tangential beam 3D-CRT...
Ngày tải lên: 09/08/2014, 09:20
... biotin and the target proteins, and thus allows their analysis by SDS ⁄ PAGE. Subcellular fractionation of porcine striatal brain tissue Porcine brain cut in half in the saggital plane was obtained fresh ... Because of the a- syn-mediated effect on DA uptake, abnormal function or aggregation of a- syn in dopaminergic neu- rons may affect the DA balance, and thereby incre...
Ngày tải lên: 14/02/2014, 21:20
... GIF, in 1991, sparked considerable interest in understanding the role of all MTs in the brain, and particularly within the injured or diseased brain. In the case of GIF, the protein has many neuroprotective ... Kohmura E, Sakaki T, Nonaka M, Yamada K, Yamashita T, Kishiguchi T, Sakaguchi T & Hayakawa T (1997) Expression of growth inhibitory factor mRNA after focal...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... evaluating the in uence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different onconase (ONC) variants at 25 °C and pH 2.0. (C Gdm/HCl ) ½ 13 , midpoint of guanidinium ... M., Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F. (1991) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeiana an...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTA CTTGAGTCA Sy...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... However, the position of the samples in Fig. 4A is in uenced by the level of all variables in these samples. For example, the samples of the strains in the third quadrant of Fig. 4A have a tendency ... in the two PCs. The variables in the third quadrant are all negatively correlated to NADPH in the two PCs. The variables in the fourth quadran...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence ppt
... common to all D isoforms. Mutational analysis of DNS indicated that two separ- ate regions in DNS, the N-terminal seven amino acids and the two C-terminal amino acids, are essential for nuclear import ... Nakashima K, Hagiwara T & Yamada M (2002) Nuclear localization of peptidylarginine deiminase V and histone deimination in granulocytes. J Biol Chem 277, 49562–49568. 44 Adam...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx
... are located in the United States, and who maintain an approval rating of at least 90%. Turkers are allowed a maximum of 30 minutes to work on the HIT, and are paid one US dollar for an accepted ... Turk Crowdsourcing services such as AMT have made large-scale data annotation and collection efforts fi- nancially affordable by granting anyone with ba- sic programming skills access to...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Ligand binding promotes prion protein aggregation – role of the octapeptide repeats potx
... top of the gradient. Fig. 2. Characterization of the heparin enhanced aggregation of rPrP. (A) Comparison of the aggregation of rPrP enhanced by hepa- rin, low molecular mass heparin (LMW heparin, ... that an increase in the number of octapeptide repeats causes conformational changes at the N-terminus, resulting in an enhancement in the binding of PrP ligands,...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Polypyrimidine tract binding protein regulates alternative splicing of an aberrant pseudoexon in NF1 pdf
... extract. Coomassie staining of the SDS–PAGE gel showed a very prominent change in the binding profile of protein bands migra- ting in the 60 kDa range (boxed area, Fig. 1C). In particular, the intensity ... correction of aberrant splicing caused by activation of cryptic splice sites. J Hum Genet 52, 891–897. 27 Garcia-Blanco MA, Baraniak AP & Lasda EL (2004) Alterna...
Ngày tải lên: 16/03/2014, 04:20