Báo cáo khoa học: "Circulating lymphocyte number has a positive association with tumor response in neoadjuvant chemoradiotherapy for advanced rectal cancer" docx
... chemoradiotherapy for advanced rectal cancer Joji Kitayama*, Koji Yasuda, Kazushige Kawai, Eiji Sunami and Hirokazu Nagawa Abstract Although neoadjuvant chemoradiotherapy (CRT) is the standard treatment ... information JK participated in the study design and data retrieval and analysis. KY, KK, ES participated in data retrieval and analysis. HN participated in the management...
Ngày tải lên: 09/08/2014, 09:20
... in data analysis and interpretation, manuscript drafting and final approval CY participated in data acquisition and analysis, manuscript drafting and final approval; BL participated in data acquisition ... acquisition and analysis, manuscript drafting and final approval; GW participated in study design, data analysis and interpretation, manuscript drafting and final approval; JMK part...
Ngày tải lên: 09/08/2014, 01:24
... Ca 2+ oscillations: a capacitative (AC) electrical coupling model in neuroepithelium Masayuki Yamashita Department of Physiology I, Nara Medical University, Kashihara, Japan Structural organization of intracellular Ca 2+ stores ... space, because I C can pass the plasma membrane capacita- tively. Thus, the current loop can be closed via the extracellular space and the plasma membrane. Thi...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx
... thetaiotaomicron anaerobic sulfatase-maturating enzyme; anSMEcp, Clostridium perfringens anaerobic sulfatase-maturating enzyme; anSMEkp, Klebsiella pneumoniae anaerobic sulfatase-maturating enzyme; ... identical post-translational modification involving the oxidation of a critical cysteinyl or a seryl residue into 3-oxoalanine. In prokaryotes, 3-oxoalanine formation is catalyzed by at le...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf
... 5¢-GCCGCTTCACTCGCCGTTACTAAGGC-3¢ [28] anti-U3 5¢-ATGGGGCTCATCAACCAAGTTGG-3¢ [49] anti-U14 5¢-CTCAGACATCCTAGGAAGG-3¢ [28] anti-snR11 5¢-GACGAATCGTGACTCTG-3¢ [20] anti-snR37 5¢-GATAGTATTAACCACTACTG-3¢ ... 5¢-GGTCTCTCTGCTGCCGGAAATG-3¢ [9] P2 5¢-CATGGCTTAATCTTTGAGAC-3¢ [8] P3 5¢-GCTCTCATGCTCTTGCCAAAAC-3¢ [9] P4 5¢-CGTATCGCATTTCGCTGCGTTC-3¢ [9] P5 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢ [13] P6 5¢-GTT...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢. [ 3 H]dTTP (10 l M ;10CiÆmmol )1 ) and enzymes were added as indicated in the figure legends, and incubated for ... Nagasawa, K., Kitamura, K., Yasui, A. , Nimura, Y., Ikeda, K., Hirai, M., Matsukage, A. & Nakanishi, M. (2000) Identification and characterization of human DNA polymerase b2, a DNA pol...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Enzymes that hydrolyze adenine nucleotides of patients with hypercholesterolemia and inflammatory processes potx
... [9]. Platelets also accumulate within atherosclerotic lesions, and can recruit additional platelets to form a thrombus, indicating that the arterial wall can assume both an in ammatory and prothrombogenic ... recognized for the significant role that they play in modulating a variety of processes related to vascular in ammation and thrombosis [16–19]. In this vein, recent data from...
Ngày tải lên: 16/03/2014, 10:20
báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf
... confirmed remarkable improvement of affected brain (Figure 2 c). Figure 1 Axial T2-weighted MR image (a) showing a mass with mixed signal intensity and a surrounding edema area. On the T1-weighted image after ... the administration of contrast material (b and c), the mass has an inhomogeneous enhancement. Sagittal T1- weighted MR image without contrast (d) depicting a striped hemorr...
Ngày tải lên: 09/08/2014, 02:20
Báo cáo khoa học: "The "Win-Win" initiative: a global, scientifically based approach to resource sparing treatment for systemic breast cancer therapy" pdf
... col- laboration and coordinating efforts and ideas. • Formation of a collaborative task force group that aims at more availability and affordability of systemic cancer therapy in LMCs. • A published ... resources for cancer management are available. In most breast cancer cases systemic cancer treatment remains a primary management strategy. With the increasing costs of novel dru...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo khoa học: "Weak expression of cyclooxygenase-2 is associated with poorer outcome in endemic nasopharyngeal carcinoma: analysis of data rom randomized trial between radiation alone versus concurrent chemo-radiation (SQNP-01)" pdf
... concur- rent chemoradiotherapy followed by adjuvant chemother- apy in patients with American Joint Committee on Cancer/ International Union against cancer stage III and IV nasopha- ryngeal cancer of ... were included in this study. 58 out of these 88 patients had suf- ficient pre-treatment paraffin-embedded biopsy material available for analysis. Institutional review board approval...
Ngày tải lên: 09/08/2014, 10:20