Báo cáo y học: "Identification of novel citrullinated autoantigens of synovium in rheumatoid arthritis using a proteomic approach" pdf

... 7(5):309-313 â Ivyspring International Publisher. All rights reserved Research Paper Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less? Hong ... analysis of sol- id -pseudopapillary tumor of the pancreas: report of 15 cases. Hepatobilliary Pancreat Dis Int. 2008;7(2):196-200. 10. Yu CC, Yeh CN,...

Ngày tải lên: 25/10/2012, 11:40

... orresponded with the minimum of the inhibitory activity in the cell cycle. The activity of DNA polymerases in the nuclear extracts after neutralization of the inhibitory activity by spermidine hydrochloride Although ... 2002 The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in t...

Ngày tải lên: 31/03/2014, 21:21

... Immunization of mice and rabbits with yeast derived H1N1HA recombinant protein To evaluate the elicitation of neutralising antibodies against the yeast expressed Hemagglutinin recombinant protein, BALB/c ... hemagglutinin protein of H1N1 using yeast system (Pichia pastoris) in secreted form. The yeast derived HA protein is capable of eliciting v...

Ngày tải lên: 18/06/2014, 18:20

... protection reported in clinical trials are corroborated by changing levels of circulating COMP. Rheumatoid arthritis patients commencing treatment with infliximab (N= 32) or etanercept (N = 17) were monitored ... ame- liorating inflammation [7]. In subsequent trials, the effect of COMP = cartilage oligomeric matrix protein (thrombospondin-5); CRP = C-reactive protein;...

Ngày tải lên: 09/08/2014, 01:21

... peptide, neuropeptide Y, vasoactive intestinal polypeptide (VIP), BN/GRP and SP were all detectable in synovial fluid, only Commentary Gastrin-releasing peptide, substance P and cytokines in rheumatoid arthritis Paul ... between two neuropeptides, bombesin/gastrin-releasing peptide and substance P, and the proinflammatory cytokine interleukin-6 as well as the e...

Ngày tải lên: 09/08/2014, 06:23

... treatment the gene expression profile of patients benefiting from the therapy changed toward the profile of healthy control individuals, whereas the profile of patients who turned out to be nonresponders ... blood Commentary Safety concerns on the development of novel therapeutic drugs Caroline Ospelt and Steffen Gay Center of Experimental Rheumatology, Zürich, S...

Ngày tải lên: 09/08/2014, 08:22

... duration 10 years) and had previously failed to respond to aggressive therapy, as reflected by a failure to respond to a median of four disease-modifying antirheumatic drugs. Infliximab therapy was for ... and weighting of the DAS28 score by means of a discriminant analysis. The coefficients obtained by discriminant analysis were similar to Letter Response to the...

Ngày tải lên: 09/08/2014, 08:22

... Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with rheumatoid ... K, Ochiai A, Hirohata S, Shimizu M, Watanabe Y: High diagnostic value of anticalpastatin autoantibodies in rheumatoid arthritis detected by ELISA using human erythrocyte calp...

Ngày tải lên: 09/08/2014, 08:23

... Teerlink T, van dorp W, Stehouwer CDA: Effect of a treatment strategy consisting of pravastatin, vitamin E, and homocysteine lowering on carotid intima- media thickness, endothelial function, and ... inflammation. In healthy people, the inflammatory response elicited by vaccination is sufficient to temporarily (and reversibly) impair endothelial function [7]. Reduction of inflammati...

Ngày tải lên: 09/08/2014, 10:22

... poten- tial in vivo consequences of hypoxia in RA in terms of synovial invasion, by exposing RA synovial membrane cells to 1% oxy- gen. In our study, hypoxia upregulated MMP-2, MMP-8 and MMP-9, ... expression by rheumatoid arthritis synovial cellsHypoxia modulates gelatinase expression by rheumatoid arthritis synovial cells. Rheumatoid arthritis synovial cells were e...

Ngày tải lên: 09/08/2014, 14:20

... signaling? Unfortunately, they did not include in their studies the therapeutic impact of the targeting antibody alone, without Editorial Immunocytokines: the long awaited therapeutic magic bullet ... against a specific target fused to a cytokine, thus retaining the functions of both the antibody and the cytokine. In cancer, the use of single-chain antibody fragm...

Ngày tải lên: 09/08/2014, 14:22

... solitary parotid gland disease is uncommon; patients generally also have systemic disease. Case Presentation: We report a case of Wegener's Granulomatosis in a 69-year-old Caucasian female presenting ... presenting initially with an isolated parotid abscess and only subsequently developing nasal, paranasal sinus and respiratory symptoms. We describe the clinic...

Ngày tải lên: 11/08/2014, 19:21

... article Separating therapeutic efficacy from glucocorticoid side-effects in rodent arthritis using novel, liposomal delivery of dexamethasone phosphate: long-term suppression of arthritis facilitates interval ... increased therapeutic potency of liposomal DXM- P resulted also in a significant reduction of urinary pyridinoline, indicating an...

Ngày tải lên: 12/08/2014, 11:22

... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region. YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...

Ngày tải lên: 14/08/2014, 14:21

... R51 Research Identification, characterization and comparative genomics of chimpanzee endogenous retroviruses Nalini Polavarapu, Nathan J Bowen and John F McDonald Address: School of Biology, Georgia Institute of Technology, ... old world monkeys than in chimpanzees. Endogenous retroviral positional variation between chimpanzees and humans Comparative analyses of o...

Ngày tải lên: 14/08/2014, 16:21