Báo cáo khoa học: " SemiCytokines levels, Severity of acute mucositis and the need of PEG tube installation during chemo-radiation for head and neck cancer a prospective pilot study" ppt
Báo cáo khoa học: " SemiCytokines levels, Severity of acute mucositis and the need of PEG tube installation during chemo-radiation for head and neck cancer a prospective pilot study" ppt
... 134:821-832. doi:10.1186/1748-717X-5-16 Cite this article as: Meirovitz et al.: Cytokines levels, Severity of acute mucositis and the need of PEG tube installation during chemo-radiation for head and neck cancer - a prospective pilot study. ... levels and a need for a PEG tube. Conclusion: These preliminary results, indicating a corr...
Ngày tải lên: 09/08/2014, 08:22
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... C-domain of the NRPS catalyzes the a- N-acetylation of haOrn 1 in cis. Cyclorelease of the assembled tetrapeptide mediated by the C-terminal C-domain of...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx
... of Queensland, Brisbane, Queensland, Australia Marsupials are born in an immature state and many of the developmental processes that occur in these mammals take place during pouch life [1]. After ... and materials This work was approved by The University of Adelaide Animal Ethics Committee. Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, containing ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. The...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt
... fmolÆmg )1 CD38 +/+ PS ST ATP ADP β-NAD + ADPR + cADPR AMP Ado ATP ADP β-NAD + ADPR + cADPR AMP Ado CD38 –/– PS ST ATP β-NAD + ADPR + cADPR AMP Ado ATP ADP β-NAD + ADPR + cADPR AMP Ado B A ATP ADP β-NAD + ADPR + cADPR AMP Ado ST, ... increased formation of ATP, we examined the effect of carbachol, a stable analog of acetylcholine, on the spontaneous overflow of ATP. Carbachol (...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
... to characterize complex formation at the adapter protein, linker for activation of T cells Jon C. D. Houtman, Mira Barda-Saad and Lawrence E. Samelson Laboratory of Cellular and Molecular Biology, ... overlap, a favorable ori- entation and a separation of 1–10 nm [52]. Because of the ability of FRET to measure only close interactions, it is a valuable approach for...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Cyclosporin A-induced oxidative stress is not the consequence of an increase in mitochondrial membrane potential doc
... increases in cytosolic [Ca 2+ ] in response to CsA and its analogs. Both the intra- cellular Ca 2+ chelator BAPTA and the extracellular Ca 2+ chelator EGTA caused significant attenua- tion of the ... microtiter plate (Greiner Bio-One B.V., Alphen aan den Rijn, the Netherlands). CsA and its analogs (0.1–10 lm) were added. Five minutes after addition of the CsA and its anal...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf
... erythrocytes. Hemag- glutination by PSKP-1 and PSKP-1 K was inhibited by EDTA and heparin. Certain basic proteins have ancillary antibacterial activ- ity. Some examples are aprotinin, SLPI, and CAP18 [39,40]. All ... Da of the experimental value (7185.8 vs. 7185.3 Da). Bioinformatic studies AccordingtostandardaminoacidpK a in water, the theoretical pI of unfolded and fully r...
Ngày tải lên: 30/03/2014, 13:20
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx
... sto- mach. His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojeju- nostomy and a drain by the duodenal repair and his abdomen closed. The drains were ... informed consent was obtained from the patient for publication of this case report and any accompany- ing images. A copy of the written consent is avail able for rev...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx
... 9:15 http://www.jnanobiotechnology.com/content/9/1/15 Page 10 of 11 TTCAGAACC-3’ (291 bp), Alb S:5’ -TCAACGTCA- GAGCAGAGAAGC-3 ’ ,A: 5’-AGACTGCCTTGTGTG- GAAGACT-3’ , (145), AFP S: 5’ -GTGAAACAGACTT CCTGGTCCT -3’ ,A: 5’ -GCC CACAGACCATGAAA- CAAG-3 ... gene expression assays described in the manuscript, statistical data analysis and has drafted the manuscript. CR has provided the inte...
Ngày tải lên: 11/08/2014, 00:23