Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
... text words) relating to NSAIDs (for instance, anti-inflammatory agents, non steroidal anti-inflammatory) and AMI (for instance, myocardial infarction, myocardial ischemia, cardiac ischemia, death) were ... colorectal adenomas and carcinomas. Cochrane Database Syst Rev 2004, 2:CD004079. 8. Cryer B, Feldman M: Cyclooxygenase-1 and cyclooxygenase-2 selectivity of widely used nonsteroid...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: " Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study" pdf
... latter approach also takes into account subthreshold symp- toms of anxiety and depression, which may also adverselyaffectdailylife[24,25].Thepresentstudy revealed statistically significant associations ... may also be associated with micronutrient deficiencies that adversel y affect mental health. Inadequate intake of nutrients and energy may lead to deficiency of folic acid, thiami...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Construction of Metabolically Biotinylated Adenovirus with Deleted Fiber Knob as Targeting Vector" ppsx
... antibodies are chemically biotinylated. Without a defined biotin site, chemically biotinylated antibodies can be attached to avidin in any orientation, often interfering with their ability to bind antigens. ... metabolically biotinylated Fab frag- ments against rat APP (833cb Fab) which has one biotin residues located at the C-terminal side of the C1 domain of the heavy chain [17]. We...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... 2 analysis of variance (ANOVA). For the first data analysis, treatment and time were the independent factors using all 23 subjects. The second analysis sep- arated and analyzed the data according ... Safety of bitter orange (Citrus au- rantium) and its primary alkaloid p-synephrine. HerbalGram 2011; 89: 34-39. 13. Haller CA, Duan M, Peyton J III, et al. Human pharmacology of a per...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: "Management of Critically Ill Patients with Severe Acute Respiratory Syndrome (SARS)"
... mortality in all 60 clinically-defined SARS patients, mean age 30.5 years. With 40% treated with CPAP and none requiring mechanical ventilation. Subsequently, very low mortality was again recorded ... Fowler R .A. , et al. Critically ill patients with severe acute respiratory syndrome. JAMA, 2003. 290:367-73. 48. Kwan A. , et al. Tracheostomy in a patient with severe acute...
Ngày tải lên: 03/11/2012, 10:20
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Research Centre for Critical Care ... collection, analysis, and reporting of de-identified data by the ANZICS-APD comply with Australian Commonwealth leg- islation (1994) enabling national quality assurance activities. They al...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "Treatment of proximal femur infections with antibiotic-loaded cement spacers"
... two-parted mould of polyoxymethylene [1]. The bone cement used in all cases was Refobacin-Palacos ® (Fa. Merck, Darmstadt, Gemany), each spacer was loaded with 4 g vancomy- cin (Fa. cell pharen ... [52-77] years. After infection eradication, a prosthesis has been reimplanted in 8 cases. One pa- tient passed away due to an unclear cause between stages, another patient (bilateral s...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo Y học:Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor docx
... for 2 min at 10 000 g.The supernatant was immunoprecipitated with mAb A1 0. Samples were analyzed by SDS/PAGE after reduction: (A) SDS/PAGE analysis; (B) quantification using a Phosphorimager, s, ... was obtained from NEN Life Science Products (Paris, France). Calnexin rabbit polyclonal antibody (SPA-860), calreticulin rabbit polyclonal antibody (SPA-600), BiP rabbit polyclo- nal antibody...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CA...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx
... placebo-controlled study of Alternaria alternata immunotherapy: Clinical efficacy and safety. Pediatr Allergy Immunol 2008, 19:67-75. 20. Asturias JA, Ibarrola I, Ferrer A, Andreu C, Lopez-Pascual ... (cat and dog), pollens (mixed grass, olive, Parietaria judaica, Artemisia, Platanus orientalis, Cupresus arizonica and Salsola kali), and moulds ( Alter- naria alternata, Aspergillus fumigatu...
Ngày tải lên: 08/08/2014, 21:20