Báo cáo y học: " Preventing autoimmune arthritis using antigen-specific immature dendritic cells: a novel tolerogenic vaccine" pptx
... CIA as determined by the average arthritis score per effected paw began approximately on day 28. Initiation of arthritis was delayed by 7 days in the CII-pulsed LF-treated DC group as compared ... generate Tol-DC in vitro by treatment with LF, which may represent a safer, more natural, and potentially clinically applicable alternative to LF systemic administration. Rheumatoid arthritis...
Ngày tải lên: 09/08/2014, 08:22
... random hexamer (Pharmacia, Uppsala, Sweden). The PCR primer sequences used were as follows. FasL (forward: 5¢-ATGTTTCAGC TCTTCCACCTACAGAAGGA-3¢,reverse:5¢-CAGAGA GAGCTCAGATACGTTGAC-3¢); and b-actin ... substrate 4-methyl-lum- bellifery-b-galactoside, and was normalize d for protein content [30]. A one-way analysis of variance was performed using GraphPad INSTAT Ò (GraphPad Software, San D...
Ngày tải lên: 24/03/2014, 03:21
... Ishikawa S, Nagai S, Sato T, Akadegawa K, Yoneyama H, Zhang YY, Onai N, Matsushima K: Increased circulating CD11b+CD11c+ dendritic cells (DC) in aged BWF1 mice which can be matured by TNF-alpha into ... ery- thematosus. Science 2001, 294:1540-1543. 6. Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanza- vecchia A, Colonna M: Plasmacytoid monocytes migrate to inflamed lymph nod...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Dysfunctional interferon-α production by peripheral plasmacytoid dendritic cells upon Toll-like receptor-9 stimulation in patients with systemic lupus erythematosus" doc
... GAG ACA CAA G-3' Reverse: 5'-TCT GGA AGT CAC ATT CCT TGC-3' IRAK-M Forward: 5'-TTT GAA TGC AGC CAG TCT GA-3' Reverse: 5'-GCA TTG CTT ATG GAG CCA AT-3' GAPDH, ... 5'-AGT CAG CAG CCA GTC TCA G-3' PRKR Forward: 5'-CTT CCA TCT GAC TCA GGT TT-3' Reverse: 5'-TGC TTC TGA C G GTA TGT ATT A- 3' MyD88s Forward: 5'-CGG CAA CTG GAG .....
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... Miyawaki K, Yamada Y, Ban N, Ihara Y, Tsukiyama K, Zhou H, Fujimoto S, Oku A, Tsuda K, Toyokuni S, Hiai H, Mizunoya W, Fushiki T, Holst JJ, Makino M, Tashita...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... flow cytometer with data analysis using EXPO 32 ADC software (Coulter Corporation, Miami, FL). A minimum of 10,000 cells were analyzed in each FACS evaluation. Functional analysis of hES-DCs by Mixed ... cytokine media and analyzed by FACS for CD14 and CD 1a markers at different days by staining with CD 1a- PECY5 and CD14-PE conjugated anti- bodies. Dot plots are representative of tripl...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps
... particularly in terms of graft patency. Intimal hyperplasia can cause aneurysm and thrombus formation [1]. In our study, on Days 1 and 7 post-ABS application, histopathological changes in the rat abdominal ... impair the quality of anastomosis. To preserve the quality of anastomosis, adjuvant topical hemostatic agents are favored in cardiac and vascular sur- gery. However, topical hemostatic...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Minimally Invasive Parathyroidectomy Using Surgical Sonography"
... sestamibi scan. The anatomic approach and closure are as de- scribed above. Postoperative Management All patients were examined by the surgical housestaff on a daily basis for wound hematomas ... size and early discharge. Key words: Minimally invasive parathyroidectomy, surgical sonography Introduction Primary hyperparathyroidism (pHPT) is a common endocrine disorder, which can af...
Ngày tải lên: 25/10/2012, 11:04
Báo cáo y học: "Collagen-induced arthritis is exacerbated in IL-10-deficient mice" pps
... levels and a dramatic increase in CD11b-positive macrophages. Paradoxically, both the IgG 1 and IgG 2a anticollagen antibody responses were also significantly reduced. These data demonstrate that ... established collagen-induced arthritis. Arthritis Rheum 1996, 39:495. 20. Tanaka Y, Otsuka T, Hotokebuchi T, Miyahara H, Nakashima H, Kuga S, Nemoto Y, Niiro H, Niho Y: Effect of IL-10...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... fetal bovine serum and 0.02% NaN 3 ; and fixed with 1% paraformaldehyde. Analysis was performed on a FACS-Calibur (Becton Dickinson, San Jose, CA, USA) using FlowJo software (TreeStar, San Carlos, ... considered statistically significant. The JMP statistical analysis program was used (SAS, Cary, NC, USA). Results Naïve and memory subpopulations of CD4 + and CD8 + T cells from RA and SLE p...
Ngày tải lên: 09/08/2014, 01:21