Báo cáo y học: "Autoantibodies against the replication protein A complex in systemic lupus erythematosus and other autoimmune diseases" pps
Báo cáo y học: "Autoantibodies against the replication protein A complex in systemic lupus erythematosus and other autoimmune diseases" pps
... interests The authors declare that they have no competing interests. Authors' contributions YY carried out the immunoassays, participated in the data analysis and in the design of the study, and ... these autoantibodies [30]. In PM/DM, patients with anti- aminoacyl tRNA synthetase antibodies have antibodies against only one of the synthetases, and other patien...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Identity of mysterious CD4+CD25–Foxp3+ cells in systemic lupus erythematosus" pps
... by Yang and colleagues [1] was recently pub lished in this journal and another by Bonelli and colleagues [2] was published elsewhere. Here, we discuss the essence of the controversy and approaches ... non-Tregs. Because of these confl icting observations, they conducted a new study, and the report by Yang and colleagues [1] was published in a recent issue of thi...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Antibodies against the CB10 fragment of type II collagen in rheumatoid arthritis" pdf
... dis- ease. At entry to the study, 78% had active disease, and the median Ritchie Articular Index was 5 (range 0–25). The median age at onset was 45 years (range 15–77), and the median duration ... (CII) and human CIICorrelation of antibodies against bovine type II collagen (CII) and human CII. Scatter plot of the levels of IgG antibodies against human CII and bovine...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Autoantibodies predate the onset of systemic lupus erythematosus in northern Sweden" potx
... Sweden. Authors’ contributions CE analysed and interpreted the data and was involved in drafting the manuscript. HK analysed and interpreted the data and was to some extent involved in drafting the ... the study, analysed and interpreted the data and was involved in drafting the manuscript. All authors have given their final approval of the version of the m...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
... of the catalytic proteinase domain of TNFa converting enzyme (green) and human neutrophil collagenase (magenta) after the binding of a hydroxamate and a barbiturate inhibitor, respectively [22,46]. ... respectively. (C) and (D), the S )1 pockets of adamalysin II (cyan) and atrolysin C (blue) after the binding of a phosphonate inhibitor and the batimastat, respectivel...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Characterization of the 105-kDa molecular chaperone Identification, biochemical properties, and localization pptx
... brain. We have investigated the localization and developmental induction of the protein in the rat brain. In the immuno- histochemical analysis, the protein was mainly detected in the cytoplasm of the ... 105-kDa protein, we studied the cross-reactivity of an antibody against APG-1 with the 105-kDa protein. As shown in Fig. 6, the purified 105-kDa protein...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... (5¢)3¢) GenBank acc. no. COX IV a AGAAGGCGCTGAAGGAGAAGGA CCAGCATGCCGAGGGAGTGA NM_009941 NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077 b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ACCGCTCGTTGCCAATAGTGATG ... microscopy the surface area of about 130±170 cells for each animal was measured by an Image Analyzer KS100 IBAS Kontron ( Karl Zeiss Jena, Germany), in o rder to calcula...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: ":Evaluation of the Patient Acceptable Symptom State in a pooled analysis of two multicentre, randomised, double-blind, placebo-controlled studies evaluating lumiracoxib and celecoxib in patients with osteoarthritis" pptx
... – was originally estimated using the least square means obtained from an analysis of covariance with study and baseline values as covariates. Table 1 Patient demographics and baseline disease ... Pharma AG [Basel, Switzerland]). Authors' contributions MD, AM, SY, and XG conceived the study and participated in its design and coordination. SY and AM performed the statis...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "RANKL increases the level of Mcl-1 in osteoclasts and reduces bisphosphonate-induced osteoclast apoptosis in vitro" pps
... highly regulated by survival-promoting factors via the PI3K/Akt/ mammlian target of rapamycin (mTOR)/S6 kinase as well as mitogen-activated protein kinase (MAPK) signalling pathways [39,40]. The latter are ... perhaps since the activation of mTOR/S6 kinase in osteoclasts appears to involve geranylger- anylated proteins such as Rac [41], and ALN is known to effectively prevent pro...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: "Presence of the CYP2B6 516G T polymorphism, increased plasma Efavirenz concentrations and early neuropsychiatric side effects in South African HIV-infected patients" pptx
... main catalyst of efavirenz primary and secondary metabolism: implication for HIV/AIDS therapy and utility of efavirenz as a substrate marker of CYP2B6 catalytic activity. J Pharmacol ExpTherapy 2003, ... een treatment efficacy and EFV plasma concentrations has been weak in other studies [28-31]. Twenty percent of participants enrolled in the study were not included in the...
Ngày tải lên: 10/08/2014, 05:21