Báo cáo y học: "A cell-cycle independent role for p21 in regulating synovial fibroblast migration in rheumatoid arthritis" pps

... transport in insulin-stimulated GLUT4 translocation remains controversial. The idea that transport of GSVs along microtubules is indispensable for insulin-stimu- lated GLUT4 translocation ... EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, Guilhaus M et al. (2005) Characterization of the role of the Rab GTPase-activating protein AS160 in insulin- regulated GLUT4 tr...

Ngày tải lên: 16/03/2014, 06:20

... ACa 2+ /CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter Sona Pandey*, Shiv B. Tiwari † , Wricha Tyagi, Mali K. Reddy, Kailash C. Upadhyaya and ... Interaction of pea nuclear proteins with AtCaM5 promoter and supershift analysis. The nuclear proteins were used in GMSAs to analy...

Ngày tải lên: 18/03/2014, 01:20

... these enzymes. QUINOPROTEIN AND FLAVOPROTEIN AMINE DEHYDROGENASES The quinoprotein and flavoprotein amine dehydrogenases are ideally suited to studies of H-transfer. The reactions catalysed are ... enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes Michael J. Sutcliffe 1,2 and Nigel S. Scrutton 1 D...

Ngày tải lên: 31/03/2014, 23:20

... RESEARCH Open Access A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Konstantinos N Fountoulakis 1* , Melina Siamouli 2 , Stamatia ... Inventory. BMC Psychiatry 2003, 3:2. doi:10.1186/1744-859X-10-19 Cite this article as: Fountoulakis et al.: A standardized scoring method for the...

Ngày tải lên: 09/08/2014, 01:21

... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R ... FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGAT...

Ngày tải lên: 09/08/2014, 07:20

... cell cycle inhibitor with high homology to p21, also plays a role in regulating cell migration. While our data suggest that FLS lacking p21 have enhanced migratory ability, this recent study reports ... reports that murine embryonic fibroblasts lacking p27 exhibit a dramatic decrease in cell motility, the exact opposite response, in a cell-cycle independent manner. p21 (-/...

Ngày tải lên: 09/08/2014, 08:22

... Previously, Garred and coworkers [23] showed that MBL2 exon 1 variant allele carrier status was associated with early age at onset of RA, which is the adult counterpart of polyarthritis [26]. Garred and ... and low expression of MBL. The influence of the X /Y allele was also determined by studying six 'extended' genotype groups: YA/YA, YA/XA, XA/XA, YA/O, XA/O and...

Ngày tải lên: 09/08/2014, 10:23

... cigarette smoking associates with reduced BMI and BF in patients with RA and heavy smoking associates with lower muscle mass. Smoking cessation appears to associate with increased BMI, BF, and waist ... identify potential associations of smoking with body weight and composition of RA patients. Methods A total of 392 patients (290 females)...

Ngày tải lên: 09/08/2014, 10:23

... inflammatory response in RA [25]. Alternatively, androgens may influence RA risk indirectly through conversion to estradiol by aromatase or directly by binding to the androgen receptor and affecting cell ... number not for citation purposes) Vol 11 No 3 Research article A prospective study of androgen levels, hormone-related genes and risk of rheumatoid arthritis E...

Ngày tải lên: 09/08/2014, 14:22

... graph of the number of datasets contributing to the set of reference nucleosome positions (including hypothetical positions) . (c) Illustration of the types of nucleosomes in the yeast genome, and ... R109 Software A compiled and systematic reference map of nucleosome positions across the Saccharomyces cerevisiae genome Cizhong Jiang *† a...

Ngày tải lên: 09/08/2014, 20:20

... reality of RNA-seq data analysis is not this simple; normalization is often still an important consideration. Current RNA-seq analysis methods typically standar- dize data between samples by scaling ... the analysis. We outline a simp le and effective method for performing normalization and show dramatically improved results for inferring differential expression in...

Ngày tải lên: 09/08/2014, 20:21

... MS/MS Yes Yes Yes Yes Database of lipid masses Yes Yes Yes Yes Yes Yes Database of spectra Yes Database expandability Yes Yes Yes Yes Yes Isotopic correction Yes Yes Yes Yes Cross-platform Yes Yes ... 12:R8 http://genomebiology.com/2011/12/1/R8 Page 22 of 25 METH O D Open Access A novel informatics concept for high-throughput shotgun lipidomics based on the molecular f...

Ngày tải lên: 09/08/2014, 22:23

... performance The margin of probability r was set at 0.05 for the base calling. The performance was summarized in Table 2. Table 2 SNP- specific calling performance SNP 1 SNP 2 SNP 3 SNP 4 SNP 5 SNP ... A base-calling algorithm for Tm-shifted melting curve SNP assay. Journal of Clinical Bioinformatics 2011 1:3. Liang et al. Journal of Clinical Bioinformatics 2011, 1...

Ngày tải lên: 10/08/2014, 09:22

... perioperative red blood cell transfusion in elective cardiac surgery, especially in transfusion- prone patients: a prospective, randomized controlled trial George Vretzakis 1 , Athina Kleitsaki 1 , Konstantinos ... red blood cell transfusion in elective cardiac surgery, especially in transfusion- prone patients: a prospective, rando...

Ngày tải lên: 10/08/2014, 10:20

... al.: A case-series study to explore the efficacy of foot orthoses in treating first metatarsophalangeal joint pain. Journal of Foot and Ankle Research 2010 3:17. Submit your next manuscript to BioMed ... This is in agreement with other authors who have explored the efficacy of variously produced foot o rthoses for other indications [45,46]. Contrary...

Ngày tải lên: 10/08/2014, 21:24