Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... 4 Research article Differential expression, function and response to inflammatory stimuli of 11 β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation ... 5 Induction of 11 β-HSD1 expression is specific for inflammatory cytokinesInduction of 11 β-HSD1 expression is specific for inflammatory...

Ngày tải lên: 09/08/2014, 08:22

... prenatal effect on inflammatory hyperalgesia. Using carrageenan-induced plantar inflam- mation and plantar test, we observed a more severe hyperalgesia in offspring from morphine-treated dams. Again, ... AGCCAAGAGGAGGAAACAGC/ ACCTCCACTGACCGAA TCTC for NR2B). Using Kodak Digital Science 1D ima ge analysis software, quan- titative analysis was performed after scanning of the ethi- d...

Ngày tải lên: 10/08/2014, 10:20

... Intracellular staining for cytokines was performed using BD cytofix/cytoperm and BD perm/wash reagents with GolgiStop as recommended by BD Pharmingen. Intracellular cytokine staining was per- formed using ... inflammatory Nikota et al. Respiratory Research 2 011 , 12 :39 http://respiratory-research.com/content /12 /1/ 39 Page 10 of 12 [10 ,11 ], much ambiguity remains. Understand...

Ngày tải lên: 12/08/2014, 13:22

... chromogen [11 ,12 ]. The polyclonal antibodies, goat antihuman Ang -1 and Ang-2, and rabbit antihuman Tie1 and Tie2, were pur- chased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Additionally, goat antihuman ... ligands Names Forward primers TaqMan probes Reverse primers Ang -1 GCC ATT ACC AGT CAG AGG CAG T CAT GCT AAG AAT TGA GTT AAT AAT AGG CTC GGT TCC CTT CC Ang-2 CGC TCG...

Ngày tải lên: 09/08/2014, 03:24

... in patients with RA. Correlation factor (Spearman's) and P value are indicated (GraphPad software). Figure 9 CXCL10 concentrations in seraCXCL10 concentrations in sera. Sera of healthy ... with cyclophosphamide (6). Available online http://arthritis-research.com/content/7/5/R10 01 R1 013 13 . Matsui T, Akahoshi T, Namai R, Hashimoto A, Kurihara Y, Rana M, Nishimura A, End...

Ngày tải lên: 09/08/2014, 06:23

... nuclear factor-kappa-B activation. In summary, RANK-L is expressed by inflammatory and normal neutrophils, unlike OPG and RANK, which are expressed only by neutrophils exposed to an inflammatory ... detection of the mRNA. OPG, osteoprotegerin; PCR, polymerase chain reaction; RANK, receptor activator of nuclear factor-kappa-B; RANK-L, ligand of receptor activator of nuclea...

Ngày tải lên: 09/08/2014, 10:20

... members of a family of nonreceptor protein tyrosine kinases that are acti- vated by a variety of extracellular stimuli [1] . FAK and Pyk2 associate with the cytoskeleton and with integrin-signaling complexes ... upregulated in RA versus OA and ND lining cells and sublining MΦs. Activation of the FAK family signaling cascade on RA and OA lining cells may be responsibl...

Ngày tải lên: 09/08/2014, 10:21

... mycobacterial 38-kilodalton glycolipoprotein antigen activates the mitogen-activated protein kinase pathway and release of proinflammatory cytokines through Toll-like receptors 2 and 4 in human ... 4) and TST negative (n = 7) subjects. TLR ligands induce production of pro -inflammatory cytokines by bronchoalveolar cells and monocytes To assess the cytokine-inducing function...

Ngày tải lên: 12/08/2014, 14:20

... Germany) and transferred to a S-VHS video system for subsequent offline analysis. Microcirculatory analysis For quantitative offline analysis a computer-assisted microcir- culation image analysis ... (Table 3). Inflammatory cell response in synovial tissue Although the animals exhibited no clinical symptoms of arthritic disease, synovial tissue was characterized by an inf...

Ngày tải lên: 09/08/2014, 06:23

... number of replicates in data sets of interest is often too small to estimate both p arameters, mean and variance, reliably for each gene. For edgeR,Robinson and Smyth assumed [11 ] that mean and variance ... estimates for the data of Nagalakshmi et al. [1] . The data allow assessment of technical variability (between library preparations from aliquots of the same yea...

Ngày tải lên: 09/08/2014, 22:23