Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... 4Research articleDifferential expression, function and response to inflammatory stimuli of 11 β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation ... 5Induction of 11 β-HSD1 expression is specific for inflammatory cytokinesInduction of 11 β-HSD1 expression is specific for inflammatory cytokines. (a) Bone marrow, and (b) dermal and (c) synovial ... GCGATGGTCTCAGAAACCAAACReverse primer: GAGATTACAGAGGAAGTTATCCTCTGCProbe: TGCAGTGAAGGTTGCTGAGGCTCTGAGRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CTReverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTAProbe:...
- 10
- 438
- 0
Báo cáo y học: "Dextromethorphan attenuated the higher vulnerability to inflammatory thermal hyperalgesia caused by prenatal morphine exposure in rat offspring" docx
... prenatal effect on inflammatory hyperalgesia. Using carrageenan-induced plantar inflam-mation and plantar test, we observed a more severehyperalgesia in offspring from morphine-treated dams.Again, ... AGCCAAGAGGAGGAAACAGC/ACCTCCACTGACCGAA TCTC for NR2B). UsingKodak Digital Science 1D ima ge analysis software, quan-titative analysis was performed after scanning of the ethi-dium bromide-stained ... impacts of prenatal exposure of morphine on the vulnerability to hyperalgesia have never been examined. In humans, theliability to inflammatory hyperalgesia is often affected byacquired physical...
- 7
- 220
- 0
Báo cáo y học: " Differential expression and function of breast regression protein 39 (BRP-39) in murine models of subacute cigarette smoke exposure and allergic airway inflammation" pps
... Intracellular staining for cytokineswas performed using BD cytofix/cytoperm and BDperm/wash reagents with GolgiStop as recommended byBD Pharmingen. Intracellular cytokine staining was per-formed using ... inflammatory Nikota et al. Respiratory Research 2 011 , 12 :39http://respiratory-research.com/content /12 /1/ 39Page 10 of 12 [10 ,11 ], much ambiguity remains. Understanding thecellular and molecular mechanisms ... utilized for eachstain and are demonstrated in Additional File 1. Statistical analysisData are expressed as means ± SEMs. Statistical analysiswas performed with SPSS statistical software version 17 .0...
- 12
- 307
- 0
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc
... chromogen [11 ,12 ]. The polyclonal antibodies, goat antihuman Ang -1 and Ang-2, and rabbit antihuman Tie1 and Tie2, were pur-chased from Santa Cruz Biotechnology (Santa Cruz, CA,USA). Additionally, goat antihuman ... ligandsNames Forward primers TaqMan probes Reverse primersAng -1 GCC ATT ACC AGT CAG AGG CAG T CAT GCT AAG AAT TGA GTT AAT AAT AGG CTC GGT TCC CTT CCAng-2 CGC TCG AAT ACG ATG ACT CG TGC AGA ... normal synovial tissues (6%). The inflamma-tory and vascularity scores were higher in RA synovialtissue in comparison to OA and normal. In accordancewith the staining data, RA synovial tissue...
- 9
- 424
- 0
Báo cáo y học: "Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus" ppsx
... in patients with RA. Correlation factor (Spearman's) and P value are indicated (GraphPad software).Figure 9CXCL10 concentrations in seraCXCL10 concentrations in sera. Sera of healthy ... with cyclophosphamide (6).Available online http://arthritis-research.com/content/7/5/R10 01 R1 013 13 . Matsui T, Akahoshi T, Namai R, Hashimoto A, Kurihara Y, Rana M,Nishimura A, Endo H, Kitasato ... of ifn-inducible PROTEIN -10 relating to the activity of systemiclupus erythematosus. Cytokine 2000, 12 :15 61- 1565.Open AccessAvailable online http://arthritis-research.com/content/7/5/R10 01 R10 01 Vol...
- 13
- 504
- 0
Báo cáo y học: "Differential expression of RANK, RANK-L, and osteoprotegerin by synovial fluid neutrophils from patients with rheumatoid arthritis and by healthy human blood neutrophils" doc
... nuclear factor-kappa-B activation. In summary, RANK-L is expressed by inflammatory and normalneutrophils, unlike OPG and RANK, which are expressed onlyby neutrophils exposed to an inflammatory ... detection of the mRNA. OPG, osteoprotegerin; PCR, polymerase chain reaction; RANK, receptor activator of nuclear factor-kappa-B; RANK-L, ligand of receptor activator of nuclear factor-kappa-B; TRAF6, ... important role in the IL-4-induced protectionfrom apoptosis. Int Immunol 20 01, 13 :14 79 -14 87.39. McDonald PP, Bald A, Cassatella MA: Activation of the NF-kap-paB pathway by inflammatory stimuli in...
- 12
- 477
- 0
Báo cáo y học: "Differential expression of the FAK family kinases in rheumatoid arthritis and osteoarthritis synovial tissues" doc
... members of a family of nonreceptor protein tyrosine kinases that are acti-vated by a variety of extracellular stimuli [1] . FAK and Pyk2associate with the cytoskeleton and with integrin-signalingcomplexes ... upregulated in RA versus OA and ND lining cells and sublining MΦs.Activation of the FAK family signaling cascade on RA and OAlining cells may be responsible for cell adhesion and migrationinto ... quantification data obtained from a, b and c. Bars represent mean and SEM. Inflam, inflammatory score; Vasc, vascularity score; Lining, ST lining cell layer; Mac, subsynovial MΦs.Available online...
- 10
- 393
- 0
Báo cáo y học: " Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes" pdf
... mycobacterial 38-kilodaltonglycolipoprotein antigen activates the mitogen-activated protein kinasepathway and release of proinflammatory cytokines through Toll-likereceptors 2 and 4 in human ... 4) and TST negative (n =7) subjects.TLR ligands induce production of pro -inflammatory cytokines by bronchoalveolar cells and monocytes To assess the cytokine-inducing functional capability of TLR2, ... determined in culture supernatants by ELISA for TNF -a and IL-6 (A, C) and Cytokine Bead Array for IL-1b IL -10 and IL -12 (B, D and E). Culture medium and human DNA (5 mg/mL) were used asnegative...
- 13
- 251
- 0
Báo cáo y học: "Gene expression profile and synovial microcirculation at early stages of collagen-induced arthritis" pot
... Germany) and transferred to a S-VHS video system for subsequent offline analysis.Microcirculatory analysis For quantitative offline analysis a computer-assisted microcir-culation image analysis ... (Table3). Inflammatory cell response in synovial tissueAlthough the animals exhibited no clinical symptoms of arthritic disease, synovial tissue was characterized by an inflammatory cell response ... and taking a P < 0.0 01 as thethreshold for significance.Table 1 Summary of adhesion molecules and chemokines/cytokines differentially expressed in CIA joints at early stages of disease and...
- 9
- 429
- 0
Báo cáo y học: "Differential expression analysis for sequence count data" ppt
... number of replicates in data sets of interest isoften too small to estimate both p arameters, mean and variance, reliably for each gene. For edgeR,Robinson and Smyth assumed [11 ] that mean and variance ... estimates for the data of Nagalakshmi et al. [1] .The data allow assessment of technical variability (between librarypreparations from aliquots of the same yeast culture) and biologicalvariability ... variance-stabilizing transformation.AcknowledgementsWe are grateful to Paul Bertone for sharing the neural stem cells data ahead of publication, and to Bartek Wilczyński, Ya-Hsin Liu, Nicolas...
- 12
- 369
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ