Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''''''s disease" docx
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
... experiments and participated in the design of the study and analysis of the data. FC participated in the design of the study and in the anal- ysis of data and helped to draft the manuscript. PM cloned and sequenced ... and revision of the study. AS partic- ipated in the analysis and interpretation of data and helped to draft the manuscri...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf
... recombinant ApTR showed high thermosta- bility, and the half-life of heat inactivation was about 4 min at 110 °C. Furthermore, the heat stability of ApTR was enhanced by the addition of FAD to the incubation mixture, ... of Advanced Industrial Science and Technology (Kansai), Ikeda, Osaka, Japan We have identified and characterized a thermostable thio- redoxin system i...
Ngày tải lên: 23/03/2014, 21:20
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, except ... 2002 RESULTS Isolation of a 2Cys-Prx by using a single cysteine mutant of Chlamydomonas Trx h In an attempt to isolate new T rx targets in Chlamydomonas, a...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
... carboxylase and c-carboxyglutamic acid are phylogenetically older than blood coagulation, although carboxylation was initially discovered during the study of mammalian blood coagulation. The synthesis ... enhances carboxylase activity are the same or distinct. Analysis of enzymatic properties of the Conus carboxylation system, which has many functional similarities to the ma...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx
... 5¢-GC (A, G)TG (A, G,T)AT (A, G,T)AT (A, G)TC (A, C,G,T)GTCCA-3¢ (corresponding to amino acids 86–91 in tri in) ; latisemin, sense 5¢-GA (A, G)AA(C,T)CA (A, G)AA (A, G)GA (A, G)AT (A, C,T)G-3¢ (corresponding to amino acids 11–17 in latisemin) ... Hishinuma 2 , Mitsuo Mita 2 and Takashi Morita 1 Departments of 1 Biochemistry; and 2 Pharmacodynamics, Meiji Pharmaceutical University,...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... Kawai, J., Shinagawa, A. , Shibata, K., Yoshino, M., Itoh, M., Ishii, Y. , Arakawa, T., Hara, A. , Fukunishi, Y. , Konno, H., Adachi, J., Fukuda, S., Aizawa, K., Izawa, M., Nishi, K., Kiyo- sawa,H.,Kondo,S.,Yamanaka,I.,Saito,T.,Okazaki ,Y. , Gojobori, ... encoding a nuclear 24 kDa protein Bianca Backofen 1, *, Ralf Jacob 2, *, Katrin Serth 3 , Achim Gossler 3 , Hassan Y. Naim 2 and T...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot
... cells a cDNA + d ND Bovine Mammary gland c cDNA + d + d Mammary gland c cDNA library + d + Lung c –+ d ND Lymph node c –+ d ND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer ... polyacrylamide gels. Antibody staining of sections from bovine prelactating and lactating mammary gland using monoclonal and polyclonal antibodies has shown that PA...
Ngày tải lên: 24/03/2014, 04:21
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx
... Albert M, Nallainathan D, Karaskova J, Rosen B, Murphy J, Laframboise S, et al: Parallel Analysis of Sporadic Primary Ovarian Carcinomas by Spectral Karyotyping, Comparative Genomic Hybridization, ... blocking was performed using goat IgG, then a biotinilated anti-streptavidin antibody (goat) was bound to the initial staining, and amplification was completed by the addition of a...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... AACTGGGCAGGTTGAAAATACCTTCTACATTGGATTATGTCTC E.coli promoter (44) GACG TACATGTTAATAGATGGCGTGAAGCACAGTCGTGTCAT 87 128 Bacilli promoter SD (61) GAA-TCATCAAATACATATTCAAGAAAGGGAAGAGGAGAATG AS-protease SD (63) GAAGTCTGTGGAGACATAAA-AAGAAAATGGAGTTCAACATG E.coli ... ORIGINAL ARTICLE Open Access Identification and characterization of alkaline serine protease from goat skin surface metagenome Paul...
Ngày tải lên: 21/06/2014, 05:20