Báo cáo khoa học: "Soft tissue non-Hodgkin lymphoma of shoulder in a HIV patient: a report of a case and review of the literature" pps

... Surgical OncologyOpen Access Case report Soft tissue non-Hodgkin lymphoma of shoulder in a HIV patient: a report of a case and review of the literatureDomenico Marotta*1, Alessandro Sgambato2, ... Androulaki A, Zorm-pala A, Balafouta ME, Dounis E, Tsavaris N, Kordossis T: Extranodal non-Hodgkin lymphoma presenting as a soft tissue mass in the proximal femur in a HIV( +) patient. Leuk Lymphoma ... with draft of case report. All authors read and approved the final manu-script.References1. Larocca LM, Capello D, Rinelli A, Nori S, Antinori A, Gloghini A, Cin-golani A, Migliazza A, Saglio...

Báo cáo khoa học: "Soft Syntactic Constraints for Word Alignment through Discriminative Training" pot

... re-uses a large amountinfrastructure from the matching solution. Weessentially plug an ITG parser in the place of the matching algorithm, and add features to takeadvantage of information made available ... grammars and bilingual parsing of parallel corpora. ComputationalLinguistics, 23(3):377–403.K. Yamada and K. Knight. 2001. A syntax-based statisti-cal translation model. In Meeting of the Association ... phrasal co-hesion constraint. Discriminative training allowsus to maintain all of the features that are useful to the maximum matching baseline in addition to the new syntactic features. We have...

Báo cáo khoa học: Differential tissue-speciﬁc distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebraﬁsh (Danio rerio) docx

... physiological roles for FABPs include the uptake and utilization of fatty acids, intracellulartargeting of fatty acids to speciﬁc organelles and meta-bolic pathways, and the protection of cellular ... similarity of zebraﬁsh, shark, chicken, iguana,salamander, toad, fugu, stickleback and medaka FABP sequences with zebraﬁsh Fabp10b are shown at the end of each sequence. A. B. Venkatachalam et al. fabp10b ... to the liver of nonmammalianvertebrate species. No FABP10 has been detected thusfar in mammalian species. In an initial study based on in vitro binding assays, catﬁsh FABP10 binds a singlefatty...

Báo cáo khoa học: "Soft Syntactic Constraints for Hierarchical Phrased-Based Translation" docx

... The authors wouldlike to thank David Chiang and Adam Lopez formaking their source code available; the StanfordParser team and Mary Harper for making theirparsers available; David Chiang, Amy ... maximal advantage of what can be learned from parallel training data,while effectively factoring in key aspects of linguis-tically motivated analysis. As a result, we obtainsubstantial improvements ... Accuracy enhancements for mandarin parsing.Tech. report, University of Maryland.Dan Klein and Christopher D. Manning. 200 3a. Accu-rate unlexicalized parsing. In Proceedings of ACL-03,pages...

Báo cáo khoa học: "Pharmacokinetics, tissue residue and plasma protein binding of ofloxacin in goats" pps

... 97–101Pharmacokinetics, tissue residue and plasma protein binding of ofloxacin in goatsHimangshu Baruah*, Dulal Chandra Roy, Rohini Kumar Roy, Hirendra Nath KhonikorDepartment of Pharmacology and ... investigation on renal handling of ofloxacin in man. In Mitsuhaski and Daiks (eds.), Ofloxacin: A new quinolones antibacterial agent. Proceedings of a workshop held at the 14th International Congress ... the objective of the present study was to investigate the pharmacokinetic pattern, tissue residue and plasma proteinbinding of the drug following single intravenousadministration in goat. The pharmacokinetic...

Báo cáo khoa học: "MicroRNA-17-92 significantly enhances radioresistance in human mantle cell lymphoma cells" pot

... 10:RA235-241.18. Kandasamy K, Srivastava RK: Role of the phosphatidylinositol 3’-kinase/PTEN/Akt kinase pathway in tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in ... not in the clinical cases in the future.PTEN is a lipid phosphatase that removes the activat-ing signal and ultimately prevents Akt phosphorylation and activation, while PHLPP2 terminates Akt ... blunt-endligat ion to generate the miRNA-17-92 cluster was ampli-fied from human genomic DNA using the following pri-mers: 5’-tttttctcgaGTGTCTAAATGGACCTCATATCTTTGAG-3’ ,and5 ’-gtttttgaattCCAAATCTGACACG-CAACCC-3’...

Báo cáo khoa học: " Normal tissue toxicity after small field hypofractionated stereotactic body radiation" pdf

... 67:768-774.57. Matsuo Y, Nagata Y, Mizowaki T, Takayama K, Sakamoto T, SakamotoM, Norihisa Y, Hiraoka M: Evaluation of mass-like consolidationafter stereotactic body radiation therapy for lung tumors. IntJ ... can change in shape and extent; it can shrink and migrate centrally towards the hilum over the course of sev-eral months of follow-up imaging.[27,55] It can alsogrow, appear as abnormal opacities, ... is Professor and Vice-chairman of the Department of Radiation Oncology at the University of Rochester. He has a long-standing interest in the study of cancer survivor-ship and treatment related...

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... located diametrically to the polecarrying the amino acids involved in substrate binding. Asfar as we know, there has been no report about structureactivity relationships in this area of the ... helix and in the vicinity of the b sheet 3–3can affect the catalytic properties of CYP 6A2 , the building of a structural model appears necessary. The only other case in which the structure/activityrelationships...

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Bioscience, The University of Queensland, Brisbane, Queensland, AustraliaMarsupials are born in an immature state and many of the developmental processes that occur in thesemammals take place during ... and materialsThis work was approved by The University of AdelaideAnimal Ethics Committee.Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich. Alamar ... assaysAntimicrobial testing on HPLC fractions and synthetic euge-nin was carried out by the Microbiology Department of the Institute of Medical and Veterinary Science (Adelaide,Australia) using a standard...

Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx

... statisticalparsing. Computational Linguistics, 30(3):253–276.Masakazu Iwatate, Masayuki Asahara, and Yuji Mat-sumoto. 2008. Japanese dependency parsing us-ing a tournament model. In Proc. of ... Than Sentences in Active Learning for Japanese Dependency ParsingManabu SassanoYahoo Japan CorporationMidtown Tower,9-7-1 Akasaka, Minato-ku,Tokyo 107-6211, Japanmsassano@yahoo-corp.jpSadao ... of improving active learning for parsingby using a smaller constituent than a sentence as a unit that is selected at each iteration of activelearning. Typically in active learning for parsing...

Xem thêm