Báo cáo khoa học: "Multiple giant scalp metastases of a follicular thyroid carcinoma" potx

... the most affected area of these metastases. Case presentation: We present a case of a 76 year old Woman with multiple giant scalp metastases of a follicular carcinoma. These metastases had been ... Corresponding author Abstract Background: The occurrence of skin metastases are rare events in the course of a follicular thyroid carcinoma (FTC) and usually in...

Ngày tải lên: 09/08/2014, 07:21

... Dickinson and Co.) was used to acquire and analyze data. A minimum of at least 10 000 cells was analyzed. Computation of specific constitutive activity (SCA) and relative SCA (RSCA) Given that the transfection ... Programma di Ricerca: Le malattie della tiroide: dalle basi molecolari alla clinica. Ministero dell’Universita ` e della Ricerca Scientifica (MURST), Programma di Ricerca: Strat...

Ngày tải lên: 08/03/2014, 08:20

... VE, Olgac S: Urachal carcinoma: a clinicopathologic analysis of 24 cases with outcome correlation. Am J Surg Pathol 2009, 33(5):659-68. 4. Ghazizadeh M, Yamamoto S, Kurokawa K: Clinical features of urachal ... CF are radi- ologists of the Department of Radiology. All authors read and approved the final manuscript. References 1. Sheldon CA, Clayman RV, Gonzalez R, Williams RD, Fraley...

Ngày tải lên: 09/08/2014, 04:21

...

Ngày tải lên: 07/08/2014, 18:21

... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... higher specific activity k cat and V max values and lower K m value of PhyH suggests that PhyH is more catalytically efficient and has a greater affinity for InsP 6 than PhyH-DII. Substrate s...

Ngày tải lên: 14/02/2014, 15:20

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal- ysis to amino acid-based chiral pharmaceuticals - exam- ples and perspectives. J Mol Catal B-Enzym 5, 1–11. 14 Liljeblad A &...

Ngày tải lên: 18/02/2014, 08:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAA...

Ngày tải lên: 19/02/2014, 06:20

... senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized, ... threshold to elesk similarity values, which yields better performance. Same as (Sinha and Mihalcea, 2007), values of elesk larger than 240 are set to 1, and the rest are mapped to [0,1]. elesk .....

Ngày tải lên: 19/02/2014, 19:20

... hemolymph of P. jacquemontii by affinity chromatography. It yielded a 2000-fold increase in specific activity. Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The ... purification. Erythrocyte preparation Blood for HA assay was prepared as described by Ravindranath et al. [12]. Hemagglutination assay Hemagglutination assays were performed in...

Ngày tải lên: 21/02/2014, 00:20

... (1990) Anaerobic lactate oxidation to 3 CO 2 by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway: demonstration of the acetyl- CoA carbon-carbon cleavage reaction in cell extracts. ... catalytic subunit of Hdr from methanogenic archaea have been deposited in the databases. None of these putative pro teins has b een c haracterized and no f unction has been assigned to...

Ngày tải lên: 21/02/2014, 03:20